Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T38257 Target Info
Target Name Phosphatase and tensin homolog (PTEN)
Synonyms TEP1; Phosphatidylinositol 3,4,5trisphosphate 3phosphatase and dualspecificity protein phosphatase PTEN; Phosphatidylinositol 3,4,5-trisphosphate 3-phosphatase and dual-specificity protein phosphatase PTEN; Mutated in multiple advanced cancers 1; MMAC1
Target Type Literature-reported Target
Gene Name PTEN
Biochemical Class Phosphoric monoester hydrolase
UniProt ID
P60484
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-21-5p by mature miRNA precursor transfection resulted in the decreased protein level of target PTEN. [34]
Evidence Score (E-score) 63 +
1 ELISA; Immunoblot; qRT-PCR [1]
2 GFP Reporter Assay; Northern Blot; qRT-PCR; Western Blot [2]
3 Immunocytochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Immunofluorescence; Immunohistochemistry; qRT-PCR; Western Blot [4]
5 Immunohistochemistry [5]
6 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
7 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
8 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
9 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
10 Immunohistochemistry; Microarray; qRT-PCR; Western Blot [10]
11 Immunohistochemistry; qRT-PCR; Western Blot [11]
12 Luciferase Reporter Assay [12]
13 Luciferase Reporter Assay [13]
14 Luciferase Reporter Assay [14]
15 Luciferase Reporter Assay [15]
16 Luciferase Reporter Assay [16]
17 Luciferase Reporter Assay [17]
18 Luciferase Reporter Assay [18]
19 Luciferase Reporter Assay [19]
20 Luciferase Reporter Assay; [20]
21 Luciferase Reporter Assay; Microarray; Northern Blot; qRT-PCR; Western Blot [21]
22 Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot [22]
23 Luciferase Reporter Assay; qRT-PCR [23]
24 Luciferase Reporter Assay; qRT-PCR; Western Blot [24]
25 Luciferase Reporter Assay; qRT-PCR; Western Blot [25]
26 Luciferase Reporter Assay; qRT-PCR; Western Blot [26]
27 Luciferase Reporter Assay; qRT-PCR; Western Blot [27]
28 Luciferase Reporter Assay; qRT-PCR; Western Blot [28]
29 Luciferase Reporter Assay; qRT-PCR; Western Blot [29]
30 Luciferase Reporter Assay; qRT-PCR; Western Blot [30]
31 Luciferase Reporter Assay; qRT-PCR; Western Blot [31]
32 Luciferase Reporter Assay; qRT-PCR; Western Blot [32]
33 Luciferase Reporter Assay; qRT-PCR; Western Blot [33]
34 Luciferase Reporter Assay; qRT-PCR; Western Blot [34]
35 Luciferase Reporter Assay; Western Blot [35]
36 Luciferase Reporter Assay; Western Blot [36]
37 Luciferase Reporter Assay; Western Blot [37]
38 Luciferase Reporter Assay; Western Blot; Microarray [38]
39 Luciferase Reporter Assay; Western Blot; qRT-PCR [39]
40 Microarray; Immunohistochemistry [40]
41 Microarray; qRT-PCR; Western Blot [41]
42 Northern Blot; qRT-PCR; Western Blot; Reporter Assay [42]
43 qRT-PCR; Luciferase Reporter Assay; Western Blot [43]
44 qRT-PCR; Luciferase Reporter Assay; Western Blot [44]
45 qRT-PCR; Western Blot [45]
46 qRT-PCR; Western Blot [46]
47 qRT-PCR; Western Blot [47]
48 qRT-PCR; Western Blot [48]
49 qRT-PCR; Western Blot [49]
50 qRT-PCR; Western Blot [50]
51 qRT-PCR; Western Blot [51]
52 qRT-PCR; Western Blot [52]
53 qRT-PCR; Western Blot [53]
54 qRT-PCR; Western Blot [54]
55 qRT-PCR; Western Blot [55]
56 qRT-PCR; Western Blot [56]
57 qRT-PCR; Western Blot [57]
58 qRT-PCR; Western Blot [58]
59 Western Blot [59]
60 Western Blot [60]
61 Western Blot [61]
62 Western Blot [62]
63 Western Blot [63]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 9 +
1 Luciferase Reporter Assay [64]
2 Luciferase Reporter Assay [65]
3 Luciferase Reporter Assay [66]
4 Luciferase Reporter Assay [67]
5 Luciferase Reporter Assay; qRT-PCR; Western Blot [68]
6 Luciferase Reporter Assay; Western Blot [69]
7 Luciferase Reporter Assay; Western Blot [70]
8 Luciferase Reporter Assay; Western Blot; qRT-PCR [71]
9 Western Blot; Luciferase Reporter Assay [72]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-214-3p miRNA Info
miRNA Mature AC
MIMAT0000271
Sequence acagcaggcacagacaggcagu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-214-3p resulted in the decreased protein level of target PTEN; The Underexpression by 2'-O-Me Antisense miRNA Oligonucleotides resulted in the increased protein level of target PTEN. [34]
Evidence Score (E-score) 9 +
1 Immunocytochemistry; qRT-PCR; Western Blot [73]
2 Luciferase Reporter Assay [74]
3 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [75]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [76]
5 Luciferase Reporter Assay; qRT-PCR; Western Blot [77]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [34]
7 qRT-PCR; Luciferase Reporter Assay; Western Blot [43]
8 qRT-PCR; Western Blot [78]
9 Western Blot; qRT-PCR; Luciferase Reporter Assay [79]
Representative Target(s) Regulated by This miRNA Activating transcription factor 4 (ATF-4) Target Info
ATF4_HUMAN
ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Evidence Score (E-score) 8 +
1 In Situ Hybridization; Luciferase Reporter Assay; qRT-PCR; Western Blot [80]
2 Luciferase Reporter Assay [81]
3 Luciferase Reporter Assay [64]
4 Luciferase Reporter Assay [67]
5 Luciferase Reporter Assay [34]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [82]
7 qRT-PCR; Western Blot [83]
8 qRT-PCR; Western Blot [84]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-221-3p by Anti-miRNA resulted in the changed protein level of target PTEN. [34]
Evidence Score (E-score) 7 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [85]
2 Luciferase Reporter Assay [86]
3 Luciferase Reporter Assay; Northern Blot; Western Blot [87]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [88]
5 Luciferase Reporter Assay; qRT-PCR; Western Blot [89]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [90]
7 Luciferase Reporter Assay; qRT-PCR; Western Blot [34]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-222-3p miRNA Info
miRNA Mature AC
MIMAT0000279
Sequence agcuacaucuggcuacugggu
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-222-3p by Anti-miRNA resulted in the changed protein level of target PTEN. [34]
Evidence Score (E-score) 7 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [85]
2 Luciferase Reporter Assay; Northern Blot; Western Blot [87]
3 Luciferase Reporter Assay; Northern Blot; Western Blot; Luciferase Immunocytochemistry [34]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [88]
5 Microarray; qRT-PCR; Western Blot [91]
6 qRT-PCR; Western Blot [92]
7 Western Blot [93]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
miRNA Mature ID hsa-miR-205-5p miRNA Info
miRNA Mature AC
MIMAT0000266
Sequence uccuucauuccaccggagucug
miRNA Species Homo sapiens
Regulation Mechanism miR-205 targets tumor-suppressor PTEN and consequently activates the PI3K/Akt pathway. [98]
Evidence Score (E-score) 5 +
1 ChIP; ELISA; Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [94]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [95]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [96]
4 Luciferase Reporter Assay; Western Blot [97]
5 qRT-PCR; Western Blot [98]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-29a-3p by mature miRNA precursor transfection resulted in the decreased protein level of target PTEN. [34]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay [99]
2 Luciferase Reporter Assay [100]
3 Luciferase Reporter Assay [34]
4 Microarray; qRT-PCR; Western Blot [91]
5 qRT-PCR; Western Blot [101]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-106a induced DDP resistance involved the expression of phosphatase and tensin homolog delted from chromosome 10 (PTEN) protein and its downstream phosphatidylinositol 3 kinase (PI3K)/proten kinase B (AKT) pathway. [40]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [102]
2 Luciferase Reporter Assay; Western Blot [103]
3 Luciferase Reporter Assay; Western Blot [40]
4 qRT-PCR; Western Blot [104]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-494-3p miRNA Info
miRNA Mature AC
MIMAT0002816
Sequence ugaaacauacacgggaaaccuc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-494-3p by mature miRNA precursor transfection resulted in the decreased protein level of target PTEN. [34]
Evidence Score (E-score) 4 +
1 Immunofluorescence; Immunohistochemistry; qRT-PCR; Western Blot [105]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [106]
3 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [34]
4 qRT-PCR; Luciferase Reporter Assay; Western Blot [107]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-93 plays a critical role in regulating CDDP chemosensitivity through suppression of PTEN expression, and it may serve as a potential target for overcoming CDDP resistance in human ovarian cancer. [108]
Evidence Score (E-score) 4 +
1 GFP Reporter Assay; Western Blot [108]
2 Luciferase Reporter Assay [109]
3 Luciferase Reporter Assay [110]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [111]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-18a-5p miRNA Info
miRNA Mature AC
MIMAT0000072
Sequence uaaggugcaucuagugcagauag
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [112]
2 Luciferase Reporter Assay [113]
3 Luciferase Reporter Assay; Western Blot [70]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Regulation Mechanism mir-23a directly target PTEN. [116]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [114]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [115]
3 Luciferase Reporter Assay; Western Blot [116]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-32-5p miRNA Info
miRNA Mature AC
MIMAT0000090
Sequence uauugcacauuacuaaguugca
miRNA Species Homo sapiens
Regulation Mechanism PTEN is a potential target of miR-32 in MSCs. [119]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [117]
2 Luciferase Reporter Assay; Western Blot [118]
3 qRT-PCR; Western Blot [119]
Representative Target(s) Regulated by This miRNA Aurora kinase A (AURKA) Target Info
AURKA_HUMAN
F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
miRNA Mature ID hsa-miR-10b-5p miRNA Info
miRNA Mature AC
MIMAT0000254
Sequence uacccuguagaaccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism miR-10b targets PTEN. The reduction of PTEN protein expression by miR-10b was dependent on its direct binding to its 3-UTR. [122]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [120]
2 Luciferase Reporter Assay [121]
3 Luciferase Reporter Assay [122]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-130b-3p miRNA Info
miRNA Mature AC
MIMAT0000691
Sequence cagugcaaugaugaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism In the case of PTEN , all miR-17-19-130 superfamily members were able to bind to the 3'UTR and significantly repress luciferase activity. [64]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [123]
2 Luciferase Reporter Assay [124]
3 Luciferase Reporter Assay [64]
Representative Target(s) Regulated by This miRNA Acyl-CoA desaturase (SCD) Target Info
ACOD_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-20b-5p miRNA Info
miRNA Mature AC
MIMAT0001413
Sequence caaagugcucauagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 HITS-CLIP [125]
2 Luciferase Reporter Assay [126]
3 Luciferase Reporter Assay; qRT-PCR [127]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-216a-5p miRNA Info
miRNA Mature AC
MIMAT0000273
Sequence uaaucucagcuggcaacuguga
miRNA Species Homo sapiens
Regulation Mechanism PTEN is identified as functional downstream targets of miR-216a. [129]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [128]
2 Luciferase Reporter Assay; Western Blot [129]
3 Luciferase Reporter Assay; Western Blot [62]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
miRNA Mature ID hsa-miR-92b-3p miRNA Info
miRNA Mature AC
MIMAT0003218
Sequence uauugcacucgucccggccucc
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 HITS-CLIP [125]
2 Luciferase Reporter Assay [130]
3 Luciferase Reporter Assay; Western Blot [131]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Dickkopf-related protein 3 (DKK3) Target Info
DKK3_HUMAN
miRNA Mature ID hsa-miR-301a-3p miRNA Info
miRNA Mature AC
MIMAT0000688
Sequence cagugcaauaguauugucaaagc
miRNA Species Homo sapiens
Regulation Mechanism miR-301a directly decreases PTEN expression in breast cancer cell lines. [133]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [123]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [132]
3 Luciferase Reporter Assay; Western Blot [133]
Representative Target(s) Regulated by This miRNA Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
Endothelial plasminogen activator inhibitor (SERPINE1) Target Info
PAI1_HUMAN
miRNA Mature ID hsa-miR-10a-5p miRNA Info
miRNA Mature AC
MIMAT0000253
Sequence uacccuguagauccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism miR10a and 10b target PTEN. [121]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [121]
2 Luciferase Reporter Assay; Western Blot [134]
Representative Target(s) Regulated by This miRNA AN1-type zinc finger protein 5 (ZFAND5) Target Info
ZFAN5_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism 3'UTR of PTEN contained putative binding sites for miR-155. [24]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [135]
2 Luciferase Reporter Assay; Western Blot [24]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-182-5p miRNA Info
miRNA Mature AC
MIMAT0000259
Sequence uuuggcaaugguagaacucacacu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [136]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [137]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism Identification of PTEN As a Target of miR-200 Family. [138]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [138]
2 Luciferase Reporter Assay; Microarray; Western Blot [139]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [66]
2 Luciferase Reporter Assay; Western Blot [70]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism miR-22 direct interacts with PTEN 3'UTR. [67]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [140]
2 Luciferase Reporter Assay [67]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-26a-1-3p miRNA Info
miRNA Mature AC
MIMAT0004499
Sequence ccuauucuugguuacuugcacg
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [141]
2 qRT-PCR; Western Blot [142]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-26b-5p miRNA Info
miRNA Mature AC
MIMAT0000083
Sequence uucaaguaauucaggauaggu
miRNA Species Homo sapiens
Regulation Mechanism Dual luciferase reporter assay indicated that PTEN was a direct target of miR-26b. [143]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [14]
2 Luciferase Reporter Assay [143]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Collagen I (COL1A2) Target Info
CO1A2_HUMAN
miRNA Mature ID hsa-miR-377-3p miRNA Info
miRNA Mature AC
MIMAT0000730
Sequence aucacacaaaggcaacuuuugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [144]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [145]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
miRNA Mature ID hsa-miR-106b-3p miRNA Info
miRNA Mature AC
MIMAT0004672
Sequence ccgcacuguggguacuugcugc
miRNA Species Homo sapiens
Regulation Mechanism Expression of miR-106a with wild type 3'UTR but not with mutant 3'UTR significantly suppressed the luciferase activity, indicating that these miR-106a directly target the 3'UTR of PTEN. [146]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [146]
2 qRT-PCR; Western Blot [147]
Representative Target(s) Regulated by This miRNA Bone morphogenetic protein 2 (BMP2) Target Info
BMP2_HUMAN
Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
miRNA Mature ID hsa-miR-718 miRNA Info
miRNA Mature AC
MIMAT0012735
Sequence cuuccgccccgccgggcgucg
miRNA Species Homo sapiens
Regulation Mechanism miR-718 targets PTEN by binding its 3'UTR. [149]
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [148]
2 Luciferase Reporter Assay; Western Blot [149]
Representative Target(s) Regulated by This miRNA Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
Vascular endothelial growth factor A (VEGFA) Target Info
VEGFA_HUMAN
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [150]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism PTEN mRNA is a direct target of miR-130a. [151]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [151]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-141-3p miRNA Info
miRNA Mature AC
MIMAT0000432
Sequence uaacacugucugguaaagaugg
miRNA Species Homo sapiens
Regulation Mechanism PTEN is A Target of miR-141. [152]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [152]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Bromodomain-containing protein 3 (BRD3) Target Info
BRD3_HUMAN
miRNA Mature ID hsa-miR-142-5p miRNA Info
miRNA Mature AC
MIMAT0000433
Sequence cauaaaguagaaagcacuacu
miRNA Species Homo sapiens
Regulation Mechanism miR-142 can target PTEN by binding 3'UTR of PTEN. [153]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [153]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-144-3p miRNA Info
miRNA Mature AC
MIMAT0000436
Sequence uacaguauagaugauguacu
miRNA Species Homo sapiens
Regulation Mechanism miR-144 directly targets PTEN in NPCells. [154]
Evidence Score (E-score) 1 +
1 Immunoprecipitation; Luciferase Reporter Assay; Western Blot [154]
Representative Target(s) Regulated by This miRNA ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) Target Info
ATS1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Regulation Mechanism Transfection of the cells with the miR-152-3p mimic potently lowered the PTEN mRNA level. [155]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [155]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-155-3p miRNA Info
miRNA Mature AC
MIMAT0004658
Sequence cuccuacauauuagcauuaaca
miRNA Species Homo sapiens
Regulation Mechanism miR-155 targeted PTEN 30-untranslated region (3'UTR) increased IRAKM and NKIRAS1 expression by competing for miR-155 binding, thereby suppressing AP-1/NF-kB activation induced by LPS. [156]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [156]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-17-3p miRNA Info
miRNA Mature AC
MIMAT0000071
Sequence acugcagugaaggcacuuguag
miRNA Species Homo sapiens
Regulation Mechanism miR-17 directly targets the 3'TR of PTEN. [146]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [146]
Representative Target(s) Regulated by This miRNA E-selectin (SELE) Target Info
LYAM2_HUMAN
Integrin alpha-5 (ITGA5) Target Info
ITA5_HUMAN
miRNA Mature ID hsa-miR-181c-5p miRNA Info
miRNA Mature AC
MIMAT0000258
Sequence aacauucaaccugucggugagu
miRNA Species Homo sapiens
Regulation Mechanism PTEN protein was evidently suppressed in the cells transfected with pre-miR-181c. [157]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [157]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-193a-3p miRNA Info
miRNA Mature AC
MIMAT0000459
Sequence aacuggccuacaaagucccagu
miRNA Species Homo sapiens
Regulation Mechanism miR-193-3p played critical role in regulating human gastric cancer through direct targeting on PTEN gene. [158]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [158]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
MIMAT0000682
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Regulation Mechanism Inhibition or over-expression of miR-200a increased or reduced the expression of PTEN, respectively. [159]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [159]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-200c-5p miRNA Info
miRNA Mature AC
MIMAT0004657
Sequence cgucuuacccagcaguguuugg
miRNA Species Homo sapiens
Regulation Mechanism The level of PTEN is reduced by knockdown of miR-200c in HCT-116 cells. [160]
Evidence Score (E-score) 1 +
1 Western Blot [160]
Representative Target(s) Regulated by This miRNA Cytochrome P450 1B1 (CYP1B1) Target Info
CP1B1_HUMAN
Epithelial cadherin (CDH1) Target Info
CADH1_HUMAN
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
MIMAT0000418
Sequence aucacauugccagggauuaccac
miRNA Species Homo sapiens
Regulation Mechanism PTEN is a Direct Target of miR-23b-3p. [161]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [161]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Carbonic anhydrase II (CA-II) Target Info
CAH2_HUMAN
miRNA Mature ID hsa-miR-25-3p miRNA Info
miRNA Mature AC
MIMAT0000081
Sequence cauugcacuugucucggucuga
miRNA Species Homo sapiens
Regulation Mechanism miR-25 direct interacts with PTEN 3'UTR. [67]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [67]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-29a-5p miRNA Info
miRNA Mature AC
MIMAT0004503
Sequence acugauuucuuuugguguucag
miRNA Species Homo sapiens
Regulation Mechanism PTEN was the direct functional target of miR-29a and was involved in radiosensitivity. [162]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [162]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29c downregulates PTEN protein by targeting the PTEN 3'UTR. [163]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [163]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-302a-3p miRNA Info
miRNA Mature AC
MIMAT0000684
Sequence uaagugcuuccauguuuugguga
miRNA Species Homo sapiens
Regulation Mechanism miR-302 targets 3'UTR of PTEN binding site to suppress PTEN expression. [164]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [164]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
miRNA Mature ID hsa-miR-425-5p miRNA Info
miRNA Mature AC
MIMAT0003393
Sequence aaugacacgaucacucccguuga
miRNA Species Homo sapiens
Regulation Mechanism Upregulated miR-425 directly targeted phosphatase and tensin homolog (PTEN) and negatively regulated its expression, which promoted cell survival upon IL-1B induction. [165]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [165]
Representative Target(s) Regulated by This miRNA Fibroblast growth factor receptor 3 (FGFR3) Target Info
FGFR3_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-429 miRNA Info
miRNA Mature AC
MIMAT0001536
Sequence uaauacugucugguaaaaccgu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [166]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
miRNA Mature ID hsa-miR-519c-3p miRNA Info
miRNA Mature AC
MIMAT0002832
Sequence aaagugcaucuuuuuagaggau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [167]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
ELAV-like protein 1 (ELAVL1) Target Info
ELAV1_HUMAN
miRNA Mature ID hsa-miR-519d-3p miRNA Info
miRNA Mature AC
MIMAT0002853
Sequence caaagugccucccuuuagagug
miRNA Species Homo sapiens
Regulation Mechanism miR-519d targets PTEN. [167]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [167]
Representative Target(s) Regulated by This miRNA Calcium-release activated calcium channel (CRACM) Target Info
CRCM1_HUMAN
E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
miRNA Mature ID hsa-miR-638 miRNA Info
miRNA Mature AC
MIMAT0003308
Sequence agggaucgcgggcggguggcggccu
miRNA Species Homo sapiens
Regulation Mechanism Inhibition of endogenous miR-638 resulted in a significant upregulation of PTEN protein level. [168]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [168]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
miRNA Mature ID hsa-miR-92a-1-5p miRNA Info
miRNA Mature AC
MIMAT0004507
Sequence agguugggaucgguugcaaugcu
miRNA Species Homo sapiens
Regulation Mechanism PTEN is a target of miR-92a-1. [169]
Evidence Score (E-score) 1 +
1 Microarray [169]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-1250-3p miRNA Info
miRNA Mature AC
MIMAT0026740
Sequence acauuuuccagcccauuca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [140]
Representative Target(s) Regulated by This miRNA Pattern recognition receptor NOD1 (NOD1) Target Info
NOD1_HUMAN
Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
miRNA Mature ID hsa-miR-200a-5p miRNA Info
miRNA Mature AC
MIMAT0001620
Sequence caucuuaccggacagugcugga
miRNA Species Homo sapiens
Regulation Mechanism miR-200a directly targeted phosphatase and tensin homolog (PTEN). [170]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [170]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
miRNA Mature ID hsa-miR-20a-3p miRNA Info
miRNA Mature AC
MIMAT0004493
Sequence acugcauuaugagcacuuaaag
miRNA Species Homo sapiens
Regulation Mechanism Expression of miR-20a with wild type 3'UTR but not with mutant 3'UTR significantly suppressed the luciferase activity, indicating that these miR20a directly target the 3'UTR of PTEN. [146]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [146]
Representative Target(s) Regulated by This miRNA Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
Smoothened homolog (SMO) Target Info
SMO_HUMAN
miRNA Mature ID hsa-miR-21-3p miRNA Info
miRNA Mature AC
MIMAT0004494
Sequence caacaccagucgaugggcugu
miRNA Species Homo sapiens
Regulation Mechanism miR-21 inhibitor can induce a significantly overexpressed PTEN at the mRNA and protein. [171]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [171]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
miRNA Mature ID hsa-miR-301a-5p miRNA Info
miRNA Mature AC
MIMAT0022696
Sequence gcucugacuuuauugcacuacu
miRNA Species Homo sapiens
Regulation Mechanism Luciferase reporter, qRT-PCR and Western blot assays showed that phosphatase and tensin homolog (PTEN) was a direct and functional target of miR-301a. [172]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [172]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
miRNA Mature ID hsa-miR-301b-3p miRNA Info
miRNA Mature AC
MIMAT0004958
Sequence cagugcaaugauauugucaaagc
miRNA Species Homo sapiens
Regulation Mechanism The miR-130 family promotes cell migration and invasion in bladder cancer through FAK and Akt phosphorylation by regulating PTEN. [123]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [123]
Representative Target(s) Regulated by This miRNA DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
Mineralocorticoid receptor (MR) Target Info
MCR_HUMAN
miRNA Mature ID hsa-miR-382-5p miRNA Info
miRNA Mature AC
MIMAT0000737
Sequence gaaguuguucgugguggauucg
miRNA Species Homo sapiens
Regulation Mechanism miR-382 induced by hypoxia promotes angiogenesis and acts as an angiogenic oncogene by repressing PTEN. [173]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [173]
Representative Target(s) Regulated by This miRNA Dopamine D1 receptor (D1R) Target Info
DRD1_HUMAN
Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
miRNA Mature ID hsa-miR-492 miRNA Info
miRNA Mature AC
MIMAT0002812
Sequence aggaccugcgggacaagauucuu
miRNA Species Homo sapiens
Regulation Mechanism PTEN may be regulated post-transcriptionally by miR-492 binding to 3'UTR of PTEN. [174]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [174]
Representative Target(s) Regulated by This miRNA Basigin (BSG) Target Info
BASI_HUMAN
Multiple tumor suppressor 1 (CDKN2A) Target Info
CDN2A_HUMAN
miRNA Mature ID hsa-miR-494-5p miRNA Info
miRNA Mature AC
MIMAT0026607
Sequence agguuguccguguugucuucucu
miRNA Species Homo sapiens
Regulation Mechanism miR-494 negatively regulates the expression of PTEN protein by directly targeting PTEN. [175]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [175]
Representative Target(s) Regulated by This miRNA C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
Dihydrothymine dehydrogenase (DPYD) Target Info
DPYD_HUMAN
miRNA Mature ID hsa-miR-518c-3p miRNA Info
miRNA Mature AC
MIMAT0002848
Sequence caaagcgcuucucuuuagagugu
miRNA Species Homo sapiens
Regulation Mechanism Inhibition of endogenous miR-638 resulted in a significant upregulation of PTEN. [168]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [168]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Estradiol 17 beta-dehydrogenase 1 (17-beta-HSD1) Target Info
DHB1_HUMAN
miRNA Mature ID hsa-miR-106a-3p miRNA Info
miRNA Mature AC
MIMAT0004517
Sequence cugcaauguaagcacuucuuac
miRNA Species Homo sapiens
Regulation Mechanism miR-106a promoted the growth and invasion of SKOV3 cells by targeting phosphatase and tensin homolog (PTEN). [176]
Evidence Score (E-score) 1 +
1 Western Blot [176]
Representative Target(s) Regulated by This miRNA Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
miRNA Mature ID hsa-miR-130a-5p miRNA Info
miRNA Mature AC
MIMAT0004593
Sequence gcucuuuucacauugugcuacu
miRNA Species Homo sapiens
Regulation Mechanism Increased miR-130a levels suppressed PTEN expression. [177]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [177]
Representative Target(s) Regulated by This miRNA Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
miRNA Mature ID hsa-miR-370-5p miRNA Info
miRNA Mature AC
MIMAT0026483
Sequence caggucacgucucugcaguuac
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [178]
Representative Target(s) Regulated by This miRNA Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
miRNA Mature ID hsa-miR-744-3p miRNA Info
miRNA Mature AC
MIMAT0004946
Sequence cuguugccacuaaccucaaccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [179]
Representative Target(s) Regulated by This miRNA Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
References  Top
REF 1 miR-21 is targeted by omega-3 polyunsaturated fatty acid to regulate breast tumor CSF-1 expression. Carcinogenesis. 2012 Oct;33(10):1897-908.
REF 2 Aberrant overexpression of microRNAs activate AKT signaling via down-regulation of tumor suppressors in natural killer-cell lymphoma/leukemia. Blood. 2009 Oct 8;114(15):3265-75.
REF 3 MicroRNA-21 regulates hTERT via PTEN in hypertrophic scar fibroblasts. PLoS One. 2014 May 9;9(5):e97114.
REF 4 AC1MMYR2, an inhibitor of dicer-mediated biogenesis of Oncomir miR-21, reverses epithelial-mesenchymal transition and suppresses tumor growth and progression. Cancer Res. 2013 Sep 1;73(17):5519-31.
REF 5 Expression of miR-21 and its targets (PTEN, PDCD4, TM1) in flat epithelial atypia of the breast in relation to ductal carcinoma in situ and invasive carcinoma. BMC Cancer. 2009 May 28;9:163.
REF 6 MicroRNA-21 promotes TGF-1-induced epithelial-mesenchymal transition in gastric cancer through up-regulating PTEN expression. Oncotarget. 2016 Oct 11;7(41):66989-67003.
REF 7 MiR-21 promotes intrahepatic cholangiocarcinoma proliferation and growth in vitro and in vivo by targeting PTPN14 and PTEN. Oncotarget. 2015 Mar 20;6(8):5932-46.
REF 8 MiR-21 regulates biological behavior through the PTEN/PI-3 K/Akt signaling pathway in human colorectal cancer cells. Int J Oncol. 2013 Jan;42(1):219-28.
REF 9 PTEN and PDCD4 are bona fide targets of microRNA-21 in human cholangiocarcinoma. Chin Med Sci J. 2012 Jun;27(2):65-72.
REF 10 Enhanced Cardioprotection by Human Endometrium Mesenchymal Stem Cells Driven by Exosomal MicroRNA21. Stem Cells Transl Med. 2017 Jan; 6(1): 209222.
REF 11 MicroRNA-21 induces resistance to the anti-tumour effect of interferon-/5-fluorouracil in hepatocellular carcinoma cells. Br J Cancer. 2010 Nov 9;103(10):1617-26.
REF 12 MicroRNA-21 induces 5-fluorouracil resistance in human pancreatic cancer cells by regulating PTEN and PDCD4. Cancer Med. 2016 Apr;5(4):693-702.
REF 13 EB-virus latent membrane protein 1 potentiates the stemness of nasopharyngeal carcinoma via preferential activation of PI3K/AKT pathway by a positive feedback loop. Oncogene. 2016 Jun 30;35(26):3419-31.
REF 14 Modulation of microRNAs in hypertension-induced arterial remodeling through the 1 and 3-adrenoreceptor pathways. J Mol Cell Cardiol. 2013 Dec;65:127-36.
REF 15 MicroRNA-21 regulates the sensitivity of diffuse large B-cell lymphoma cells to the CHOP chemotherapy regimen. Int J Hematol. 2013 Feb;97(2):223-31.
REF 16 microRNA-21 overexpression contributes to cell proliferation by targeting PTEN in endometrioid endometrial cancer. Oncol Lett. 2012 Dec;4(6):1290-1296.
REF 17 MicroRNA-21 (miR-21) expression promotes growth, metastasis, and chemo- or radioresistance in non-small cell lung cancer cells by targeting PTEN. Mol Cell Biochem. 2013 Jan;372(1-2):35-45.
REF 18 Identification of miR-21 targets in breast cancer cells using a quantitative proteomic approach. Proteomics. 2009 Mar;9(5):1374-84.
REF 19 Unsaturated fatty acids inhibit the expression of tumor suppressor phosphatase and tensin homolog (PTEN) via microRNA-21 up-regulation in hepatocytes. Hepatology. 2009 Apr;49(4):1176-84.
REF 20 Endothelial lineage differentiation from induced pluripotent stem cells is regulated by microRNA-21 and transforming growth factor 2 (TGF-2) pathways. J Biol Chem. 2014 Feb 7;289(6):3383-93.
REF 21 Involvement of miR-21 in resistance to daunorubicin by regulating PTEN expression in the leukaemia K562 cell line. FEBS Lett. 2011 Jan 21;585(2):402-8.
REF 22 MicroRNA-21 regulates expression of the PTEN tumor suppressor gene in human hepatocellular cancer. Gastroenterology. 2007 Aug;133(2):647-58.
REF 23 STAT3 activation of miR-21 and miR-181b-1 via PTEN and CYLD are part of the epigenetic switch linking inflammation to cancer. Mol Cell. 2010 Aug 27;39(4):493-506.
REF 24 MiR-21 and MiR-155 promote non-small cell lung cancer progression by downregulating SOCS1, SOCS6, and PTEN. Oncotarget. 2016 Dec 20;7(51):84508-84519.
REF 25 Methylated urolithin A, the modified ellagitannin-derived metabolite, suppresses cell viability of DU145 human prostate cancer cells via targeting miR-21. Food Chem Toxicol. 2016 Nov;97:375-384.
REF 26 Relevance of miR-21 in regulation of tumor suppressor gene PTEN in human cervical cancer cells. BMC Cancer. 2016 Mar 14;16:215.
REF 27 Systemic Delivery of Anti-miRNA for Suppression of Triple Negative Breast Cancer Utilizing RNA Nanotechnology. ACS Nano. 2015 Oct 27;9(10):9731-40.
REF 28 miR-21 promotes human nucleus pulposus cell proliferation through PTEN/AKT signaling. Int J Mol Sci. 2014 Mar 5;15(3):4007-18.
REF 29 The microRNA-21/PTEN pathway regulates the sensitivity of HER2-positive gastric cancer cells to trastuzumab. Ann Surg Oncol. 2014 Jan;21(1):343-50.
REF 30 NFB-mediated cyclin D1 expression by microRNA-21 influences renal cancer cell proliferation. Cell Signal. 2013 Dec;25(12):2575-86.
REF 31 Inhibition of miR-21 induces biological and behavioral alterations in diffuse large B-cell lymphoma. Acta Haematol. 2013;130(2):87-94.
REF 32 MicroRNA-21 modulates chemosensitivity of breast cancer cells to doxorubicin by targeting PTEN. Arch Med Res. 2011 May;42(4):281-90.
REF 33 An autoregulatory loop mediated by miR-21 and PDCD4 controls the AP-1 activity in RAS transformation. Oncogene. 2009 Jan 8;28(1):73-84.
REF 34 Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98.
REF 35 MicroRNA-21 regulates the migration and invasion of a stem-like population in hepatocellular carcinoma. Int J Oncol. 2013 Aug;43(2):661-9.
REF 36 TGF-stimulated microRNA-21 utilizes PTEN to orchestrate AKT/mTORC1 signaling for mesangial cell hypertrophy and matrix expansion. PLoS One. 2012;7(8):e42316.
REF 37 microRNA-21 promotes tumor proliferation and invasion in gastric cancer by targeting PTEN. Oncol Rep. 2012 Apr;27(4):1019-26.
REF 38 Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status. Lab Invest. 2010 Feb;90(2):144-55.
REF 39 Modulation of NF-B/miR-21/PTEN pathway sensitizes non-small cell lung cancer to cisplatin. PLoS One. 2015 Mar 23;10(3):e0121547.
REF 40 Differential expression of microRNA species in human gastric cancer versus non-tumorous tissues. J Gastroenterol Hepatol. 2009 Apr;24(4):652-7.
REF 41 Exosomal transfer of tumor-associated macrophage-derived miR-21 confers cisplatin resistance in gastric cancer cells. J Exp Clin Cancer Res. 2017 Apr 13;36(1):53.
REF 42 Involvement of human micro-RNA in growth and response to chemotherapy in human cholangiocarcinoma cell lines. Gastroenterology. 2006 Jun;130(7):2113-29.
REF 43 miR-26a and miR-214 down-regulate expression of the PTEN gene in chronic lymphocytic leukemia, but not PTEN mutation or promoter methylation. Oncotarget. 2015 Jan 20;6(2):1276-85.
REF 44 MicroRNA-21 (miR-21) represses tumor suppressor PTEN and promotes growth and invasion in non-small cell lung cancer (NSCLC). Clin Chim Acta. 2010 Jun 3;411(11-12):846-52.
REF 45 MicroRNA-21 promotes phosphatase gene and protein kinase B/phosphatidylinositol 3-kinase expression in colorectal cancer. World J Gastroenterol. 2016 Jun 28;22(24):5532-9.
REF 46 Lipid Nanoparticles Composed of Quaternary Amine-Tertiary Amine Cationic Lipid Combination (QTsome) for Therapeutic Delivery of AntimiR-21 for Lung Cancer. Mol Pharm. 2016 Feb 1;13(2):653-62.
REF 47 Nanoparticle-Delivered Antisense MicroRNA-21 Enhances the Effects of Temozolomide on Glioblastoma Cells. Mol Pharm. 2015 Dec 7;12(12):4509-17.
REF 48 Exosomal levels of miRNA-21 from cerebrospinal fluids associated with poor prognosis and tumor recurrence of glioma patients. Oncotarget. 2015 Sep 29;6(29):26971-81.
REF 49 Exosomal miR-21 derived from arsenite-transformed human bronchial epithelial cells promotes cell proliferation associated with arsenite carcinogenesis. Arch Toxicol. 2015 Jul;89(7):1071-82.
REF 50 MicroRNA-21 stimulates gastric cancer growth and invasion by inhibiting the tumor suppressor effects of programmed cell death protein 4 and phosphatase and tensin homolog. J BUON. 2014 Jan-Mar;19(1):228-36.
REF 51 Inhibition of miRNA-21 prevents fibrogenic activation in podocytes and tubular cells in IgA nephropathy. Biochem Biophys Res Commun. 2014 Feb 21;444(4):455-60.
REF 52 MicroRNA-21 activates hepatic stellate cells via PTEN/Akt signaling. Biomed Pharmacother. 2013 Jun;67(5):387-92.
REF 53 miR-21 confers cisplatin resistance in gastric cancer cells by regulating PTEN. Toxicology. 2013 Apr 5;306:162-8.
REF 54 Targeting miR-21 inhibits in vitro and in vivo multiple myeloma cell growth. Clin Cancer Res. 2013 Apr 15;19(8):2096-106.
REF 55 MiRNA-21 reverses high glucose and high insulin induced insulin resistance in 3T3-L1 adipocytes through targeting phosphatase and tensin homologue. Exp Clin Endocrinol Diabetes. 2012 Oct;120(9):553-9.
REF 56 Antagonism of miR-21 reverses epithelial-mesenchymal transition and cancer stem cell phenotype through AKT/ERK1/2 inactivation by targeting PTEN. PLoS One. 2012;7(6):e39520.
REF 57 IFN induces miR-21 through a signal transducer and activator of transcription 3-dependent pathway as a suppressive negative feedback on IFN-induced apoptosis. Cancer Res. 2010 Oct 15;70(20):8108-16.
REF 58 microRNA 21: response to hormonal therapies and regulatory function in leiomyoma, transformed leiomyoma and leiomyosarcoma cells. Mol Hum Reprod. 2010 Mar;16(3):215-27.
REF 59 Increased microRNA 21 expression contributes to arsenic induced skin lesions, skin cancers and respiratory distress in chronically exposed individuals. Toxicology. 2017 Mar 1;378:10-16.
REF 60 Triptolide reduces proliferation and enhances apoptosis of human non-small cell lung cancer cells through PTEN by targeting miR-21. Mol Med Rep. 2016 Mar;13(3):2763-8.
REF 61 MiR-21 induced angiogenesis through AKT and ERK activation and HIF-1 expression. PLoS One. 2011 Apr 22;6(4):e19139.
REF 62 MicroRNA control of signal transduction. Nat Rev Mol Cell Biol. 2010 Apr;11(4):252-63.
REF 63 Cholesteatoma growth and proliferation: posttranscriptional regulation by microRNA-21. Otol Neurotol. 2009 Oct;30(7):998-1005.
REF 64 Identification of a pan-cancer oncogenic microRNA superfamily anchored by a central core seed motif. Nat Commun. 2013;4:2730.
REF 65 Mature miR-17-5p and passenger miR-17-3p induce hepatocellular carcinoma by targeting PTEN, GalNT7 and vimentin in different signal pathways. J Cell Sci. 2013 Mar 15;126(Pt 6):1517-30.
REF 66 MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoS One. 2011 Jan 20;6(1):e16138.
REF 67 Identification of the miR-106b~25 microRNA cluster as a proto-oncogenic PTEN-targeting intron that cooperates with its host gene MCM7 in transformation. Sci Signal. 2010 Apr 13;3(117):ra29.
REF 68 miR-17 inhibitor suppressed osteosarcoma tumor growth and metastasis via increasing PTEN expression. Biochem Biophys Res Commun. 2014 Feb 7;444(2):230-4.
REF 69 mir-17-92, a cluster of miRNAs in the midst of the cancer network. Int J Biochem Cell Biol. 2010 Aug;42(8):1348-54.
REF 70 miR-19 is a key oncogenic component of mir-17-92. Genes Dev. 2009 Dec 15;23(24):2839-49.
REF 71 MicroRNA-17-5p promotes chemotherapeutic drug resistance and tumour metastasis of colorectal cancer by repressing PTEN expression. Oncotarget. 2014 May 30;5(10):2974-87.
REF 72 Stress response of glioblastoma cells mediated by miR-17-5p targeting PTEN and the passenger strand miR-17-3p targeting MDM2. Oncotarget. 2012 Dec;3(12):1653-68.
REF 73 Down-regulated miRNA-214 induces a cell cycle G1 arrest in gastric cancer cells by up-regulating the PTEN protein. Pathol Oncol Res. 2011 Dec;17(4):931-7.
REF 74 MicroRNA-214 regulates the acquired resistance to gefitinib via the PTEN/AKT pathway in EGFR-mutant cell lines. Asian Pac J Cancer Prev. 2012;13(1):255-60.
REF 75 Costimulation-dependent expression of microRNA-214 increases the ability of T cells to proliferate by targeting Pten. J Immunol. 2010 Jul 15;185(2):990-7.
REF 76 MiR-214 regulate gastric cancer cell proliferation, migration and invasion by targeting PTEN. Cancer Cell Int. 2013 Jul 8;13(1):68.
REF 77 Role of microRNA-214-targeting phosphatase and tensin homolog in advanced glycation end product-induced apoptosis delay in monocytes. J Immunol. 2011 Feb 15;186(4):2552-60.
REF 78 MicroRNA-214 promotes peritoneal metastasis through regulating PTEN negatively in gastric cancer. Clin Res Hepatol Gastroenterol. 2016 Dec;40(6):748-754.
REF 79 MicroRNA expression profiling in human ovarian cancer: miR-214 induces cell survival and cisplatin resistance by targeting PTEN. Cancer Res. 2008 Jan 15;68(2):425-33.
REF 80 miR-19a and miR-19b overexpression in gliomas. Pathol Oncol Res. 2013 Oct;19(4):847-53.
REF 81 MicroRNA-19 triggers epithelial-mesenchymal transition of lung cancer cells accompanied by growth inhibition. Lab Invest. 2015 Sep;95(9):1056-70.
REF 82 Regulation of miR-19 to breast cancer chemoresistance through targeting PTEN. Pharm Res. 2011 Dec;28(12):3091-100.
REF 83 MicroRNA-19a/b regulates multidrug resistance in human gastric cancer cells by targeting PTEN. Biochem Biophys Res Commun. 2013 May 10;434(3):688-94.
REF 84 Differential expression of PTEN-targeting microRNAs miR-19a and miR-21 in Cowden syndrome. Am J Hum Genet. 2008 May;82(5):1141-9.
REF 85 miR-221&222 regulate TRAIL resistance and enhance tumorigenicity through PTEN and TIMP3 downregulation. Cancer Cell. 2009 Dec 8;16(6):498-509.
REF 86 MicroRNA-221 induces cell survival and cisplatin resistance through PI3K/Akt pathway in human osteosarcoma. PLoS One. 2013;8(1):e53906.
REF 87 MicroRNA-221 and microRNA-222 regulate gastric carcinoma cell proliferation and radioresistance by targeting PTEN. BMC Cancer. 2010 Jul 12;10:367.
REF 88 Human aortic smooth muscle cell-derived exosomal miR-221/222 inhibits autophagy via a PTEN/Akt signaling pathway in human umbilical vein endothelial cells. Biochem Biophys Res Commun. 2016 Oct 14;479(2):343-350.
REF 89 miR-221 Promotes Epithelial-Mesenchymal Transition through Targeting PTEN and Forms a Positive Feedback Loop with -catenin/c-Jun Signaling Pathway in Extra-Hepatic Cholangiocarcinoma. PLoS One. 2015 Oct 26;10(10):e0141168.
REF 90 MiR-221 promotes trastuzumab-resistance and metastasis in HER2-positive breast cancers by targeting PTEN. BMB Rep. 2014 May;47(5):268-73.
REF 91 MiR-222 and miR-29a contribute to the drug-resistance of breast cancer cells. Gene. 2013 Nov 15;531(1):8-14.
REF 92 Metformin inhibits lung cancer cells proliferation through repressing microRNA-222. Biotechnol Lett. 2013 Dec;35(12):2013-9.
REF 93 microRNA-222 targeting PTEN promotes neurite outgrowth from adult dorsal root ganglion neurons following sciatic nerve transection. PLoS One. 2012;7(9):e44768.
REF 94 miR-205 targets PTEN and PHLPP2 to augment AKT signaling and drive malignant phenotypes in non-small cell lung cancer. Cancer Res. 2013 Sep 1;73(17):5402-15.
REF 95 miR-205 regulates A549 cells proliferation by targeting PTEN. Int J Clin Exp Pathol. 2015 Feb 1;8(2):1175-83.
REF 96 miR-205 promotes the growth, metastasis and chemoresistance of NSCLC cells by targeting PTEN. Oncol Rep. 2013 Dec;30(6):2897-902.
REF 97 Sp1-mediated transcriptional activation of miR-205 promotes radioresistance in esophageal squamous cell carcinoma. Oncotarget. 2017 Jan 24;8(4):5735-5752.
REF 98 SZ-685C exhibits potent anticancer activity in both radiosensitive and radioresistant NPC cells through the miR-205-PTEN-Akt pathway. Oncol Rep. 2013 Jun;29(6):2341-7.
REF 99 Transforming growth factor -regulated microRNA-29a promotes angiogenesis through targeting the phosphatase and tensin homolog in endothelium. J Biol Chem. 2013 Apr 12;288(15):10418-26.
REF 100 Upregulated microRNA-29a by hepatitis B virus X protein enhances hepatoma cell migration by targeting PTEN in cell culture model. PLoS One. 2011 May 5;6(5):e19518.
REF 101 MicroRNA-29a contributes to drug-resistance of breast cancer cells to adriamycin through PTEN/AKT/GSK3 signaling pathway. Gene. 2016 Nov 15;593(1):84-90.
REF 102 miR-106a confers cisplatin resistance by regulating PTEN/Akt pathway in gastric cancer cells. Acta Biochim Biophys Sin (Shanghai). 2013 Nov;45(11):963-72.
REF 103 miR-106a promotes growth and metastasis of non-small cell lung cancer by targeting PTEN. Int J Clin Exp Pathol. 2015 Apr 1;8(4):3827-34.
REF 104 Long noncoding RNA FER1L4 suppresses cancer cell growth by acting as a competing endogenous RNA and regulating PTEN expression. Sci Rep. 2015 Aug 26;5:13445.
REF 105 miR-494-3p Regulates Cellular Proliferation, Invasion, Migration, and Apoptosis by PTEN/AKT Signaling in Human Glioblastoma Cells. Cell Mol Neurobiol. 2015 Jul;35(5):679-87.
REF 106 MicroRNA-494 is required for the accumulation and functions of tumor-expanded myeloid-derived suppressor cells via targeting of PTEN. J Immunol. 2012 Jun 1;188(11):5500-10.
REF 107 Overexpressed miR-494 down-regulates PTEN gene expression in cells transformed by anti-benzo(a)pyrene-trans-7,8-dihydrodiol-9,10-epoxide. Life Sci. 2010 Jan 30;86(5-6):192-8.
REF 108 Involvement of microRNA-93, a new regulator of PTEN/Akt signaling pathway, in regulation of chemotherapeutic drug cisplatin chemosensitivity in ovarian cancer cells. FEBS Lett. 2012 May 7;586(9):1279-86.
REF 109 MicroRNA-93 inhibits ischemia-reperfusion induced cardiomyocyte apoptosis by targeting PTEN. Oncotarget. 2016 May 17;7(20):28796-805.
REF 110 miR-93 promotes cell proliferation in gliomas through activation of PI3K/Akt signaling pathway. Oncotarget. 2015 Apr 10;6(10):8286-99.
REF 111 Berberine Sensitizes Human Ovarian Cancer Cells to Cisplatin Through miR-93/PTEN/Akt Signaling Pathway. Cell Physiol Biochem. 2015;36(3):956-65.
REF 112 MicroRNA-17-92 cluster mediates the proliferation and survival of neural progenitor cells after stroke. J Biol Chem. 2013 May 3;288(18):12478-88.
REF 113 miR-18a promotes cell proliferation of esophageal squamous cell carcinoma cells by increasing cylin D1 via regulating PTEN-PI3K-AKT-mTOR signaling axis. Biochem Biophys Res Commun. 2016 Aug 12;477(1):144-9.
REF 114 MicroRNA-23a promotes myelination in the central nervous system. Proc Natl Acad Sci U S A. 2013 Oct 22;110(43):17468-73.
REF 115 MicroRNAs contribute to the anticancer effect of 1'-acetoxychavicol acetate in human head and neck squamous cell carcinoma cell line HN4. Biosci Biotechnol Biochem. 2013;77(12):2348-55.
REF 116 cAMP response element-binding protein promotes gliomagenesis by modulating the expression of oncogenic microRNA-23a. Proc Natl Acad Sci U S A. 2012 Sep 25;109(39):15805-10.
REF 117 MicroRNA-32 (miR-32) regulates phosphatase and tensin homologue (PTEN) expression and promotes growth, migration, and invasion in colorectal carcinoma cells. Mol Cancer. 2013 Apr 23;12:30.
REF 118 MicroRNA-32 promotes calcification in vascular smooth muscle cells: Implications as a novel marker for coronary artery calcification. PLoS One. 2017 Mar 20;12(3):e0174138.
REF 119 Downregulated microRNA-32 expression induced by high glucose inhibits cell cycle progression via PTEN upregulation and Akt inactivation in bone marrow-derived mesenchymal stem cells. Biochem Biophys Res Commun. 2013 Apr 19;433(4):526-31.
REF 120 miR-10b expression in breast cancer stem cells supports self-renewal through negative PTEN regulation and sustained AKT activation. EMBO Rep. 2016 May;17(5):648-58.
REF 121 TGF--induced miR10a/b expression promotes human glioma cell migration by targeting PTEN. Mol Med Rep. 2013 Dec;8(6):1741-6.
REF 122 The High Mobility Group A proteins contribute to thyroid cell transformation by regulating miR-603 and miR-10b expression. Mol Oncol. 2013 Jun;7(3):531-42.
REF 123 The miR-130 family promotes cell migration and invasion in bladder cancer through FAK and Akt phosphorylation by regulating PTEN. Sci Rep. 2016 Feb 3;6:20574.
REF 124 MiR-130b plays an oncogenic role by repressing PTEN expression in esophageal squamous cell carcinoma cells. BMC Cancer. 2015 Jan 31;15:29.
REF 125 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 126 MicroRNA-20b promotes cell growth of breast cancer cells partly via targeting phosphatase and tensin homologue (PTEN). Cell Biosci. 2014 Oct 14;4(1):62.
REF 127 Crucial role for early growth response-1 in the transcriptional regulation of miR-20b in breast cancer. Oncotarget. 2013 Sep;4(9):1373-87.
REF 128 MicroRNA-216a/217-induced epithelial-mesenchymal transition targets PTEN and SMAD7 to promote drug resistance and recurrence of liver cancer. Hepatology. 2013 Aug;58(2):629-41.
REF 129 TGF-beta activates Akt kinase through a microRNA-dependent amplifying circuit targeting PTEN. Nat Cell Biol. 2009 Jul;11(7):881-9.
REF 130 MiR-92b regulates the cell growth, cisplatin chemosensitivity of A549 non small cell lung cancer cell line and target PTEN. Biochem Biophys Res Commun. 2013 Nov 1;440(4):604-10.
REF 131 The E3 ubiquitin ligase CHIP/miR-92b/PTEN regulatory network contributes to tumorigenesis of glioblastoma. Am J Cancer Res. 2017 Feb 1;7(2):289-300.
REF 132 Glycine confers neuroprotection through microRNA-301a/PTEN signaling. Mol Brain. 2016 May 26;9(1):59.
REF 133 Upregulated microRNA-301a in breast cancer promotes tumor metastasis by targeting PTEN and activating Wnt/-catenin signaling. Gene. 2014 Feb 10;535(2):191-7.
REF 134 MiRNA-10a is upregulated in NSCLC and may promote cancer by targeting PTEN. Oncotarget. 2015 Oct 6;6(30):30239-50.
REF 135 MicroRNA-155-5p promotes hepatocellular carcinoma progression by suppressing PTEN through the PI3K/Akt pathway. Cancer Sci. 2017 Apr;108(4):620-631.
REF 136 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
REF 137 Inflammation-induced miR-802 promotes cell proliferation in cholesteatoma. Biotechnol Lett. 2014 Sep;36(9):1753-9.
REF 138 The Protective Role of microRNA-200c in Alzheimer's Disease Pathologies Is Induced by Beta Amyloid-Triggered Endoplasmic Reticulum Stress. Front Mol Neurosci. 2016 Dec 8;9:140.
REF 139 MiR-200c is a cMyc-activated miRNA that promotes nasopharyngeal carcinoma by downregulating PTEN. Oncotarget. 2017 Jan 17;8(3):5206-5218.
REF 140 Dual Action of miR-125b As a Tumor Suppressor and OncomiR-22 Promotes Prostate Cancer Tumorigenesis. PLoS One. 2015 Nov 6;10(11):e0142373.
REF 141 Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86.
REF 142 The Antitumor Effect of Metformin Is Mediated by miR-26a in Breast Cancer. Int J Mol Sci. 2016 Aug 10;17(8). pii: E1298.
REF 143 The role of microRNA-26b in human adipocyte differentiation and proliferation. Gene. 2014 Jan 10;533(2):481-7.
REF 144 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
REF 145 MicroRNA-377 predicts poor clinical outcome of gastric cancer and induces tumorigenesis by targeting multiple tumor-suppressor genes. Oncol Rep. 2015 Jul;34(1):203-10.
REF 146 Resveratrol and pterostilbene epigenetically restore PTEN expression by targeting oncomiRs of the miR-17 family in prostate cancer. Oncotarget. 2015 Sep 29;6(29):27214-26.
REF 147 Effect of miR-106b on Invasiveness of Pituitary Adenoma via PTEN-PI3K/AKT. Med Sci Monit. 2017 Mar 13;23:1277-1285.
REF 148 Chronic atrial fibrillation increases microRNA-21 in human atrial myocytes decreasing L-type calcium current. Circ Arrhythm Electrophysiol. 2014 Oct;7(5):861-8.
REF 149 HIV-1 Nef and KSHV oncogene K1 synergistically promote angiogenesis by inducing cellular miR-718 to regulate the PTEN/AKT/mTOR signaling pathway. Nucleic Acids Res. 2014 Sep;42(15):9862-79.
REF 150 miR-103/107 promote metastasis of colorectal cancer by targeting the metastasis suppressors DAPK and KLF4. Cancer Res. 2012 Jul 15;72(14):3631-41.
REF 151 Nuclear factor-B-dependent microRNA-130a upregulation promotes cervical cancer cell growth by targeting phosphatase and tensin homolog. Arch Biochem Biophys. 2016 May 15;598:57-65.
REF 152 microRNA-141 is involved in a nasopharyngeal carcinoma-related genes network. Carcinogenesis. 2010 Apr;31(4):559-66.
REF 153 Epstein-Barr Virus (EBV)-BamHI-A Rightward Transcript (BART)-6 and Cellular MicroRNA-142 Synergistically Compromise Immune Defense of Host Cells in EBV-Positive Burkitt Lymphoma. Med Sci Monit. 2016 Oct 31;22:4114-4120.
REF 154 MicroRNA-144 promotes cell proliferation, migration and invasion in nasopharyngeal carcinoma through repression of PTEN. Carcinogenesis. 2013 Feb;34(2):454-63.
REF 155 Tanshinone IIA inhibits apoptosis in the myocardium by inducing microRNA-152-3p expression and thereby downregulating PTEN. Am J Transl Res. 2016 Jul 15;8(7):3124-32.
REF 156 miR-155* mediates suppressive effect of PTEN 3'-untranslated region on AP-1/NF-B pathway in HTR-8/SVneo cells. Placenta. 2013 Aug;34(8):650-6.
REF 157 miR-181c promotes proliferation via suppressing PTEN expression in inflammatory breast cancer. Int J Oncol. 2015 May;46(5):2011-20.
REF 158 Downregulation of microRNA-193-3p inhibits tumor proliferation migration and chemoresistance in human gastric cancer by regulating PTEN gene. Tumour Biol. 2016 Jul;37(7):8941-9.
REF 159 MiR-200a is involved in proliferation and apoptosis in the human endometrial adenocarcinoma cell line HEC-1B by targeting the tumor suppressor PTEN. Mol Biol Rep. 2014;41(4):1977-84.
REF 160 The Effect of miR-200c Inhibition on Chemosensitivity (5- FluoroUracil) in Colorectal Cancer. Pathol Oncol Res. 2018 Jan;24(1):145-151.
REF 161 Inhibition of PTEN gene expression by oncogenic miR-23b-3p in renal cancer. PLoS One. 2012;7(11):e50203.
REF 162 MiR-29a Regulates Radiosensitivity in Human Intestinal Cells by Targeting PTEN Gene. Radiat Res. 2016 Sep;186(3):292-301.
REF 163 YAP mediates crosstalk between the Hippo and PI(3)KOR pathways by suppressing PTEN via miR-29. Nat Cell Biol. 2012 Dec;14(12):1322-9.
REF 164 miR-302 Attenuates Amyloid--Induced Neurotoxicity through Activation of Akt Signaling. J Alzheimers Dis. 2016;50(4):1083-98.
REF 165 NF-kappaB-dependent microRNA-425 upregulation promotes gastric cancer cell growth by targeting PTEN upon IL-1 induction. Mol Cancer. 2014 Feb 26;13:40.
REF 166 MicroRNA-429 induces tumorigenesis of human non-small cell lung cancer cells and targets multiple tumor suppressor genes. Biochem Biophys Res Commun. 2014 Jul 18;450(1):154-9.
REF 167 In hepatocellular carcinoma miR-519d is up-regulated by p53 and DNA hypomethylation and targets CDKN1A/p21, PTEN, AKT3 and TIMP2. J Pathol. 2012 Jul;227(3):275-85.
REF 168 Characterization of dual PTEN and p53-targeting microRNAs identifies microRNA-638/Dnm2 as a two-hit oncogenic locus. Cell Rep. 2014 Aug 7;8(3):714-22.
REF 169 Specific alterations of the microRNA transcriptome and global network structure in colorectal cancer after treatment with MAPK/ERK inhibitors. J Mol Med (Berl). 2012 Dec;90(12):1421-38.
REF 170 MiR-200a acts as an oncogene in colorectal carcinoma by targeting PTEN. Exp Mol Pathol. 2016 Dec;101(3):308-313.
REF 171 Overexpression of miR-21 promotes the proliferation and migration of cervical cancer cells via the inhibition of PTEN. Oncol Rep. 2015 Jun;33(6):3108-16.
REF 172 Expression of MicroRNA-301a and its Functional Roles in Malignant Melanoma. Cell Physiol Biochem. 2016;40(1-2):230-244.
REF 173 MicroRNA-382 induced by HIF-1 is an angiogenic miR targeting the tumor suppressor phosphatase and tensin homolog. Nucleic Acids Res. 2014 Jul;42(12):8062-72.
REF 174 MicroRNA-492 expression promotes the progression of hepatic cancer by targeting PTEN. Cancer Cell Int. 2014 Sep 20;14(1):95.
REF 175 miR-494 promotes cell proliferation, migration and invasion, and increased sorafenib resistance in hepatocellular carcinoma by targeting PTEN. Oncol Rep. 2015 Aug;34(2):1003-10.
REF 176 MicroRNA-106a regulates phosphatase and tensin homologue expression and promotes the proliferation and invasion of ovarian cancer cells. Oncol Rep. 2016 Oct;36(4):2135-41.
REF 177 Attenuation of cardiac dysfunction and remodeling of myocardial infarction by microRNA-130a are mediated by suppression of PTEN and activation of PI3K dependent signaling. J Mol Cell Cardiol. 2015 Dec;89(Pt A):87-97.
REF 178 Upregulation of microRNA-370 promotes cell apoptosis and inhibits proliferation by targeting PTEN in human gastric cancer. Int J Oncol. 2016 Oct;49(4):1589-99.
REF 179 MicroRNA 744-3p promotes MMP-9-mediated metastasis by simultaneously suppressing PDCD4 and PTEN in laryngeal squamous cell carcinoma. Oncotarget. 2016 Sep 6;7(36):58218-58233.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.