miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-519d-3p | ||||
| miRNA Stemloop AC | MI0003162 | ||||
| miRNA Stemloop ID | hsa-mir-519d | ||||
| Sequence | caaagugccucccuuuagagug | ||||
| TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-2 (MMP-2) | Successful Target | Target Info | [1] | |
| Peroxisome proliferator-activated receptor alpha (PPARA) | Successful Target | Target Info | [2] | ||
| Signal transducer and activator of transcription 3 (STAT3) | Successful Target | Target Info | [3] | ||
| RAC-gamma serine/threonine-protein kinase (AKT3) | Successful Target | Target Info | [4] | ||
| Calcium-release activated calcium channel (CRACM) | Clinical trial Target | Target Info | [5] | ||
| E2F transcription factor 1 (E2F1) | Clinical trial Target | Target Info | [6] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [4] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [4] | ||
| Proliferation marker protein Ki-67 (MKI67) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | Metalloproteinase inhibitor 2 | Regulated Protein | [4] | ||
| References | |||||
| REF 1 | MiR-519d-3p suppresses invasion and migration of trophoblast cells via targeting MMP-2. PLoS One. 2015 Mar 24;10(3):e0120321. | ||||
| REF 2 | miR-519d overexpression is associated with human obesity. Obesity (Silver Spring). 2010 Nov;18(11):2170-6. | ||||
| REF 3 | miR-519d-mediated downregulation of STAT3 suppresses breast cancer progression. Oncol Rep. 2015 Oct;34(4):2188-94. | ||||
| REF 4 | In hepatocellular carcinoma miR-519d is up-regulated by p53 and DNA hypomethylation and targets CDKN1A/p21, PTEN, AKT3 and TIMP2. J Pathol. 2012 Jul;227(3):275-85. | ||||
| REF 5 | Orai1, a Direct Target of microRNA-519, Promotes Progression of Colorectal Cancer via Akt/GSK3 Signaling Pathway. Dig Dis Sci. 2016 Jun;61(6):1553-60. | ||||
| REF 6 | EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21. | ||||
| REF 7 | MicroRNA-519d targets MKi67 and suppresses cell growth in the hepatocellular carcinoma cell line QGY-7703. Cancer Lett. 2011 Aug 28;307(2):182-90. | ||||
| REF 8 | In hepatocellular carcinoma miR-519d is up-regulated by p53 and DNA hypomethylation and targets CDKN1A/p21, PTEN, AKT3 and TIMP2. J Pathol. 2012 Jul;227(3):275-85. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.