miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-144-3p | ||||
| miRNA Stemloop AC | MI0000460 | ||||
| miRNA Stemloop ID | hsa-mir-144 | ||||
| Sequence | uacaguauagaugauguacu | ||||
| TTD Target(s) Regulated by This miRNA | Serine/threonine-protein kinase mTOR (mTOR) | Successful Target | Target Info | [1] | |
| Proto-oncogene c-Met (MET) | Successful Target | Target Info | [2] | ||
| Amyloid beta A4 protein (APP) | Successful Target | Target Info | [3] | ||
| cAMP-dependent chloride channel (CFTR) | Successful Target | Target Info | [4] | ||
| Prostaglandin G/H synthase 2 (COX-2) | Successful Target | Target Info | [5] | ||
| Transforming growth factor beta 1 (TGFB1) | Successful Target | Target Info | [6] | ||
| Enhancer of zeste homolog 2 (EZH2) | Successful Target | Target Info | [7] | ||
| Nuclear factor erythroid 2-related factor 2 (Nrf2) | Successful Target | Target Info | [8] | ||
| Notch-1 receptor (NOTCH1) | Clinical trial Target | Target Info | [9] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [10] | ||
| ADAM metallopeptidase with thrombospondin 1 (ADAMTS1) | Literature-reported Target | Target Info | [11] | ||
| Fibrinogen (FGG) | Literature-reported Target | Target Info | [12] | ||
| Protein C-ets-1 (ETS1) | Literature-reported Target | Target Info | [13] | ||
| Insulin receptor substrate-1 (IRS1) | Clinical trial Target | Target Info | [14] | ||
| Zinc finger E-box-binding homeobox 2 (ZEB2) | Literature-reported Target | Target Info | [15] | ||
| Protein(s) Regulated by This miRNA | Fibrinogen alpha chain | Regulated Protein | [12] | ||
| Fibrinogen beta chain | Regulated Protein | [12] | |||
| Mothers against decapentaplegic homolog 4 | Regulated Protein | [17] | |||
| Pre-B-cell leukemia transcription factor 3 | Regulated Protein | [18] | |||
| Titin | Regulated Protein | [19] | |||
| Zinc finger E-box-binding homeobox 1 | Regulated Protein | [15] | |||
| Zinc finger protein PLAG1 | Regulated Protein | [21] | |||
| Zinc finger X-chromosomal protein | Regulated Protein | [22] | |||
| References | |||||
| REF 1 | Downregulation of miR-144 is associated with colorectal cancer progression via activation of mTOR signaling pathway. Carcinogenesis. 2012 Dec;33(12):2391-7. | ||||
| REF 2 | MicroRNA-144 inhibits the metastasis of gastric cancer by targeting MET expression. J Exp Clin Cancer Res. 2015 Apr 17;34:35. | ||||
| REF 3 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
| REF 4 | MiR-101 and miR-144 regulate the expression of the CFTR chloride channel in the lung. PLoS One. 2012;7(11):e50837. | ||||
| REF 5 | MiR-26a and miR-144 inhibit proliferation and metastasis of esophageal squamous cell cancer by inhibiting cyclooxygenase-2. Oncotarget. 2016 Mar 22;7(12):15173-86. | ||||
| REF 6 | Post-transcriptional regulation of Transforming Growth Factor Beta-1 by microRNA-744. PLoS One. 2011;6(10):e25044. | ||||
| REF 7 | miR-144 downregulation increases bladder cancer cell proliferation by targeting EZH2 and regulating Wnt signaling. FEBS J. 2013 Sep;280(18):4531-8. | ||||
| REF 8 | Identification of novel microRNAs in post-transcriptional control of Nrf2 expression and redox homeostasis in neuronal, SH-SY5Y cells. PLoS One. 2012;7(12):e51111. | ||||
| REF 9 | DCAMKL-1 regulates epithelial-mesenchymal transition in human pancreatic cells through a miR-200a-dependent mechanism. Cancer Res. 2011 Mar 15;71(6):2328-38. | ||||
| REF 10 | MicroRNA-144 promotes cell proliferation, migration and invasion in nasopharyngeal carcinoma through repression of PTEN. Carcinogenesis. 2013 Feb;34(2):454-63. | ||||
| REF 11 | Transcriptional control of PAX4-regulated miR-144/451 modulates metastasis by suppressing ADAMs expression. Oncogene. 2015 Jun;34(25):3283-95. | ||||
| REF 12 | Regulation of fibrinogen production by microRNAs. Blood. 2010 Oct 7;116(14):2608-15. | ||||
| REF 13 | miR-144-3p, a tumor suppressive microRNA targeting ETS-1 in laryngeal squamous cell carcinoma. Oncotarget. 2016 Mar 8;7(10):11637-50. | ||||
| REF 14 | miR-144 suppresses the growth and metastasis of laryngeal squamous cell carcinoma by targeting IRS1. Am J Transl Res. 2016 Jan 15;8(1):1-11. | ||||
| REF 15 | miR-144 functions as a tumor suppressor in breast cancer through inhibiting ZEB1/2-mediated epithelial mesenchymal transition process. Onco Targets Ther. 2016 Oct 11;9:6247-6255. | ||||
| REF 16 | Regulation of fibrinogen production by microRNAs. Blood. 2010 Oct 7;116(14):2608-15. | ||||
| REF 17 | MiR-144-3p regulates osteogenic differentiation and proliferation of murine mesenchymal stem cells by specifically targeting Smad4.FEBS Lett. 2016 Mar;590(6):795-807. | ||||
| REF 18 | MicroRNA-144-3p suppresses gastric cancer progression by inhibiting epithelial-to-mesenchymal transition through targeting PBX3.Biochem Biophys Res Commun. 2017 Mar 4;484(2):241-247. | ||||
| REF 19 | Requirement of miR-144 in CsA induced proliferation and invasion of human trophoblast cells by targeting titin.J Cell Biochem. 2014 Apr;115(4):690-6. | ||||
| REF 20 | miR-144 functions as a tumor suppressor in breast cancer through inhibiting ZEB1/2-mediated epithelial mesenchymal transition process. Onco Targets Ther. 2016 Oct 11;9:6247-6255. | ||||
| REF 21 | Alterations in miRNA processing and expression in pleomorphic adenomas of the salivary gland.Int J Cancer. 2009 Jun 15;124(12):2855-63. | ||||
| REF 22 | Clinical significance of miR-144-ZFX axis in disseminated tumour cells in bone marrow in gastric cancer cases.Br J Cancer. 2012 Oct 9;107(8):1345-53. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.