miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-26a-1-3p | ||||
| miRNA Stemloop AC | MI0000083 | ||||
| miRNA Stemloop ID | hsa-mir-26a-1 | ||||
| Sequence | ccuauucuugguuacuugcacg | ||||
| TTD Target(s) Regulated by This miRNA | Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [1] | |
| Glycogen synthase kinase-3 beta (GSK-3B) | Clinical trial Target | Target Info | [2] | ||
| Protein kinase C delta (PRKCD) | Clinical trial Target | Target Info | [2] | ||
| Caspase-3 (CASP3) | Clinical trial Target | Target Info | [1] | ||
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [1] | ||
| X-linked inhibitor of apoptosis protein (XIAP) | Clinical trial Target | Target Info | [1] | ||
| M-phase inducer phosphatase 1 (MPIP1) | Literature-reported Target | Target Info | [1] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [3] | ||
| Tyrosine-protein kinase ABL2 (ABL2) | Literature-reported Target | Target Info | [1] | ||
| Transcription factor 7-like 2 (TCF7L2) | Literature-reported Target | Target Info | [2] | ||
| G1/S-specific cyclin-E2 (CCNE2) | Literature-reported Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | Apoptotic protease-activating factor 1 | Regulated Protein | [1] | ||
| Long-chain-fatty-acid--CoA ligase 3 | Regulated Protein | [2] | |||
| Long-chain-fatty-acid--CoA ligase 4 | Regulated Protein | [2] | |||
| Phosphoenolpyruvate carboxykinase, cytosolic [GTP] | Regulated Protein | [2] | |||
| References | |||||
| REF 1 | The Antitumor Effect of Metformin Is Mediated by miR-26a in Breast Cancer. Int J Mol Sci. 2016 Aug 10;17(8). pii: E1298. | ||||
| REF 2 | MicroRNA-26a regulates insulin sensitivity and metabolism of glucose and lipids. J Clin Invest. 2015 Jun;125(6):2497-509. | ||||
| REF 3 | Argonaute HITS-CLIP decodes microRNA-mRNA interaction maps. Nature. 2009 Jul 23;460(7254):479-86. | ||||
| REF 4 | The Antitumor Effect of Metformin Is Mediated by miR-26a in Breast Cancer. Int J Mol Sci. 2016 Aug 10;17(8). pii: E1298. | ||||
| REF 5 | MicroRNA-26a regulates insulin sensitivity and metabolism of glucose and lipids. J Clin Invest. 2015 Jun;125(6):2497-509. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.