miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-17-3p | ||||
| miRNA Stemloop AC | MI0000071 | ||||
| miRNA Stemloop ID | hsa-mir-17 | ||||
| Sequence | acugcagugaaggcacuuguag | ||||
| TTD Target(s) Regulated by This miRNA | Vascular endothelial growth factor receptor 2 (KDR) | Successful Target | Target Info | [1] | |
| Intercellular adhesion molecule ICAM-1 (ICAM1) | Successful Target | Target Info | [2] | ||
| Integrin alpha-5 (ITGA5) | Clinical trial Target | Target Info | [3] | ||
| E-selectin (SELE) | Clinical trial Target | Target Info | [2] | ||
| Superoxide dismutase Mn (SOD Mn) | Clinical trial Target | Target Info | [4] | ||
| Nuclear receptor coactivator 3 (NCOA3) | Literature-reported Target | Target Info | [5] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [6] | ||
| Integrin beta-3 (ITGB3) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Glutathione peroxidase 2 | Regulated Protein | [4] | ||
| Metalloproteinase inhibitor 3 | Regulated Protein | [8] | |||
| Metalloproteinase inhibitor 3 | Regulated Protein | [9] | |||
| N-acetylgalactosaminyltransferase 7 | Regulated Protein | [10] | |||
| Thioredoxin reductase 2, mitochondrial | Regulated Protein | [4] | |||
| Vimentin | Regulated Protein | [11] | |||
| References | |||||
| REF 1 | MiR-17-3p inhibits angiogenesis by downregulating flk-1 in the cell growth signal pathway. J Vasc Res. 2013;50(2):157-66. | ||||
| REF 2 | Cutting edge: TNF-induced microRNAs regulate TNF-induced expression of E-selectin and intercellular adhesion molecule-1 on human endothelial cells: feedback control of inflammation. J Immunol. 2010 Jan 1;184(1):21-5. | ||||
| REF 3 | miR-17 inhibits ovarian cancer cell peritoneal metastasis by targeting ITGA5 and ITGB1. Oncol Rep. 2016 Oct;36(4):2177-83. | ||||
| REF 4 | miR-17* suppresses tumorigenicity of prostate cancer by inhibiting mitochondrial antioxidant enzymes. PLoS One. 2010 Dec 22;5(12):e14356. | ||||
| REF 5 | Decreased expression of microRNA-17 and microRNA-20b promotes breast cancer resistance to taxol therapy by upregulation of NCOA3. Cell Death Dis. 2016 Nov 10;7(11):e2463. | ||||
| REF 6 | Resveratrol and pterostilbene epigenetically restore PTEN expression by targeting oncomiRs of the miR-17 family in prostate cancer. Oncotarget. 2015 Sep 29;6(29):27214-26. | ||||
| REF 7 | miR-17* suppresses tumorigenicity of prostate cancer by inhibiting mitochondrial antioxidant enzymes. PLoS One. 2010 Dec 22;5(12):e14356. | ||||
| REF 8 | Both mature miR-17-5p and passenger strand miR-17-3p target TIMP3 and induce prostate tumor growth and invasion.Nucleic Acids Res. 2013 Nov;41(21):9688-704. | ||||
| REF 9 | miR-17-3p Contributes to Exercise-Induced Cardiac Growth and Protects against Myocardial Ischemia-Reperfusion Injury.Theranostics. 2017 Jan 15;7(3):664-676. | ||||
| REF 10 | Mature miR-17-5p and passenger miR-17-3p induce hepatocellular carcinoma by targeting PTEN, GalNT7 and vimentin in different signal pathways. J Cell Sci. 2013 Mar 15;126(Pt 6):1517-30. | ||||
| REF 11 | MicroRNA-17-3p is a prostate tumor suppressor in vitro and in vivo, and is decreased in high grade prostate tumors analyzed by laser capture microdissection.Clin Exp Metastasis. 2009;26(8):965-79. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.