miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-182-5p
miRNA Stemloop AC MI0000272
miRNA Stemloop ID hsa-mir-182
Sequence uuuggcaaugguagaacucacacu
TTD Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [1]
Retinoic acid receptor gamma (RARG) Successful Target Target Info [2]
Glycogen synthase kinase-3 beta (GSK-3B) Clinical trial Target Target Info [3]
Serine/threonine-protein kinase Chk2 (RAD53) Clinical trial Target Target Info [4]
Brain-derived neurotrophic factor (BDNF) Clinical trial Target Target Info [5]
Thrombospondin-1 (THBS1) Clinical trial Target Target Info [6]
Phospholipase D1 (PLD1) Patented-recorded Target Target Info [7]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [8]
Cyclic AMP-responsive element-binding protein (CREB1) Literature-reported Target Target Info [9]
Forkhead box protein O1A (FOXO1) Literature-reported Target Target Info [10]
CDK inhibitor 1B p27Kip1 (CDKN1B) Literature-reported Target Target Info [4]
F-box and WD-40 domain protein 7 (Fbxw7) Literature-reported Target Target Info [11]
Melanoma differentiation-associated protein 6 (CDKN1A) Literature-reported Target Target Info [12]
T-lymphoma invasion and metastasis 1 (TIAM1) Literature-reported Target Target Info [13]
Tumor suppressor p53-binding protein 1 (TP53BP1) Literature-reported Target Target Info [4]
Neuritin (NRN1) Literature-reported Target Target Info [14]
Suppressor of tumorigenicity 15 protein (ST15) Literature-reported Target Target Info [15]
Protein(s) Regulated by This miRNA Adenylate cyclase type 6 Regulated Protein
ADCY6_HUMAN
[16]
AN1-type zinc finger protein 4 Regulated Protein
ZFAN4_HUMAN
[17]
Arrestin domain-containing protein 3 Regulated Protein
ARRD3_HUMAN
[18]
BRCA1-associated RING domain protein 1 Regulated Protein
BARD1_HUMAN
[4]
Cell adhesion molecule 1 Regulated Protein
CADM1_HUMAN
[20]
Cell cycle checkpoint protein RAD17 Regulated Protein
RAD17_HUMAN
[4]
Circadian locomoter output cycles protein kaput Regulated Protein
CLOCK_HUMAN
[21]
Cullin-5 Regulated Protein
CUL5_HUMAN
[22]
Cyclic AMP-dependent transcription factor ATF-1 Regulated Protein
ATF1_HUMAN
[4]
Cyclic AMP-responsive element-binding protein 5 Regulated Protein
CREB5_HUMAN
[4]
Cytochrome b-c1 complex subunit Rieske, mitochondrial Regulated Protein
UCRI_HUMAN
[23]
DNA-binding protein SATB2 Regulated Protein
SATB2_HUMAN
[24]
E3 ubiquitin-protein ligase TRIM8 Regulated Protein
TRIM8_HUMAN
[25]
Fibroblast growth factor 9 Regulated Protein
FGF9_HUMAN
[26]
Flotillin-1 Regulated Protein
FLOT1_HUMAN
[27]
Forkhead box protein F2 Regulated Protein
FOXF2_HUMAN
[28]
Forkhead box protein O3 Regulated Protein
FOXO3_HUMAN
[29]
G1/S-specific cyclin-D2 Regulated Protein
CCND2_HUMAN
[1]
Leucine-rich repeat-containing protein 4 Regulated Protein
LRRC4_HUMAN
[31]
Metastasis suppressor protein 1 Regulated Protein
MTSS1_HUMAN
[32]
Microphthalmia-associated transcription factor Regulated Protein
MITF_HUMAN
[1]
Microphthalmia-associated transcription factor Regulated Protein
MITF_HUMAN
[16]
Mothers against decapentaplegic homolog 4 Regulated Protein
SMAD4_HUMAN
[33]
Neural cell adhesion molecule L1-like protein Regulated Protein
NCHL1_HUMAN
[34]
Neurotrimin Regulated Protein
NTRI_HUMAN
[26]
Profilin-1 Regulated Protein
PROF1_HUMAN
[35]
Programmed cell death protein 4 Regulated Protein
PDCD4_HUMAN
[36]
Protein NDRG1 Regulated Protein
NDRG1_HUMAN
[37]
Protocadherin-8 Regulated Protein
PCDH8_HUMAN
[38]
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily D member 3 Regulated Protein
SMRD3_HUMAN
[4]
Transcription elongation factor A protein-like 7 Regulated Protein
TCAL7_HUMAN
[39]
TSC22 domain family protein 3 Regulated Protein
T22D3_HUMAN
[21]
Tumor protein p53-inducible nuclear protein 1 Regulated Protein
T53I1_HUMAN
[40]
Ubiquitin carboxyl-terminal hydrolase CYLD Regulated Protein
CYLD_HUMAN
[41]
UL16-binding protein 2 Regulated Protein
ULBP2_HUMAN
[42]
Zinc finger protein SNAI2 Regulated Protein
SNAI2_HUMAN
[43]
[Pyruvate dehydrogenase (acetyl-transferring)] kinase isozyme 4, mitochondrial Regulated Protein
PDK4_HUMAN
[44]
References
REF 1 Role of microRNA-182 in posterior uveal melanoma: regulation of tumor development through MITF, BCL2 and cyclin D2. PLoS One. 2012;7(7):e40967.
REF 2 Alterations in microRNA expression in stress-induced cellular senescence. Mech Ageing Dev. 2009 Nov-Dec;130(11-12):731-41.
REF 3 Glycogen synthase kinase 3 beta inhibits microRNA-183-96-182 cluster via the -Catenin/TCF/LEF-1 pathway in gastric cancer cells. Nucleic Acids Res. 2014 Mar;42(5):2988-98.
REF 4 MicroRNA-182-5p targets a network of genes involved in DNA repair. RNA. 2013 Feb;19(2):230-42.
REF 5 Alterations of serum levels of BDNF-related miRNAs in patients with depression. PLoS One. 2013 May 21;8(5):e63648.
REF 6 Effects of anti-miR-182 on TSP-1 expression in human colon cancer cells: there is a sense in antisense Expert Opin Ther Targets. 2013 Nov;17(11):1249-61.
REF 7 A Repertoire of MicroRNAs Regulates Cancer Cell Starvation by Targeting Phospholipase D in a Feedback Loop That Operates Maximally in Cancer Cells. Mol Cell Biol. 2016 Jan 19;36(7):1078-89.
REF 8 Elucidation of transcriptome-wide microRNA binding sites in human cardiac tissues by Ago2 HITS-CLIP. Nucleic Acids Res. 2016 Sep 6;44(15):7120-31.
REF 9 MicroRNA-182 targets cAMP-responsive element-binding protein 1 and suppresses cell growth in human gastric adenocarcinoma. FEBS J. 2012 Apr;279(7):1252-60.
REF 10 Coordinate regulation of FOXO1 by miR-27a, miR-96, and miR-182 in breast cancer cells. J Biol Chem. 2009 Aug 28;284(35):23204-16.
REF 11 Sequential expression of miR-182 and miR-503 cooperatively targets FBXW7, contributing to the malignant transformation of colon adenoma to adenocarcinoma. J Pathol. 2014 Dec;234(4):488-501.
REF 12 Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8.
REF 13 The Downregulation of MiR-182 Is Associated with the Growth and Invasion of Osteosarcoma Cells through the Regulation of TIAM1 Expression. PLoS One. 2015 May 14;10(5):e0121175.
REF 14 microRNA-182 inhibits the proliferation and migration of glioma cells through the induction of neuritin expression. Oncol Lett. 2015 Aug;10(2):1197-1203.
REF 15 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 16 MicroRNA (miRNA) transcriptome of mouse retina and identification of a sensory organ-specific miRNA cluster.J Biol Chem. 2007 Aug 24;282(34):25053-66.
REF 17 MicroRNA-182 inhibits proliferation through targeting oncogenic ANUBL1 in gastric cancer.Oncol Rep. 2015 Apr;33(4):1707-16.
REF 18 Androgen receptor regulated microRNA miR-182-5p promotes prostate cancer progression by targeting the ARRDC3/ITGB4 pathway.Biochem Biophys Res Commun. 2016 May 20;474(1):213-219.
REF 19 MicroRNA-182-5p targets a network of genes involved in DNA repair. RNA. 2013 Feb;19(2):230-42.
REF 20 TGF- upregulates miR-182 expression to promote gallbladder cancer metastasis by targeting CADM1.Mol Biosyst. 2014 Mar 4;10(3):679-85.
REF 21 Genetic variants and abnormal processing of pre-miR-182, a circadian clock modulator, in major depression patients with late insomnia.Hum Mol Genet. 2010 Oct 15;19(20):4017-25.
REF 22 Cullin-5, a ubiquitin ligase scaffold protein, is significantly underexpressed in endometrial adenocarcinomas and is a target of miR-182.Oncol Rep. 2016 Apr;35(4):2461-5.
REF 23 Knockdown of miR-182 promotes apoptosis via regulating RIP1 deubiquitination in TNF--treated triple-negative breast cancer cells. Tumour Biol. 2016 Oct;37(10):13733-13742.
REF 24 microRNA-182 targets special AT-rich sequence-binding protein 2 to promote colorectal cancer proliferation and metastasis.J Transl Med. 2014 May 1;12:109.
REF 25 miR-182 promotes tumor growth and increases chemoresistance of human anaplastic thyroid cancer by targeting tripartite motif 8.Onco Targets Ther. 2017 Feb 24;10:1115-1122.
REF 26 miR-182 inhibits Schwann cell proliferation and migration by targeting FGF9 and NTM, respectively at an early stage following sciatic nerve injury.Nucleic Acids Res. 2012 Nov 1;40(20):10356-65.
REF 27 Downregulation of microRNA-182-5p contributes to renal cell carcinoma proliferation via activating the AKT/FOXO3a signaling pathway.Mol Cancer. 2014 May 17;13:109.
REF 28 MicroRNA-182-5p promotes cell invasion and proliferation by down regulating FOXF2, RECK and MTSS1 genes in human prostate cancer. PLoS One. 2013;8(1):e55502.
REF 29 Aberrant miR-182 expression promotes melanoma metastasis by repressing FOXO3 and microphthalmia-associated transcription factor.Proc Natl Acad Sci U S A. 2009 Feb 10;106(6):1814-9.
REF 30 Role of microRNA-182 in posterior uveal melanoma: regulation of tumor development through MITF, BCL2 and cyclin D2. PLoS One. 2012;7(7):e40967.
REF 31 Disturbing miR-182 and -381 inhibits BRD7 transcription and glioma growth by directly targeting LRRC4.PLoS One. 2014 Jan 3;9(1):e84146.
REF 32 MiR-182 overexpression in tumourigenesis of high-grade serous ovarian carcinoma.J Pathol. 2012 Oct;228(2):204-15.
REF 33 Oncogenic miRNA-182-5p targets Smad4 and RECK in human bladder cancer. PLoS One. 2012;7(11):e51056.
REF 34 miR-182 targets CHL1 and controls tumor growth and invasion in papillary thyroid carcinoma.Biochem Biophys Res Commun. 2014 Jul 18;450(1):857-62.
REF 35 Expression and regulatory function of miRNA-182 in triple-negative breast cancer cells through its targeting of profilin 1.Tumour Biol. 2013 Jun;34(3):1713-22.
REF 36 MicroRNA-182 promotes cell growth, invasion, and chemoresistance by targeting programmed cell death 4 (PDCD4) in human ovarian carcinomas.J Cell Biochem. 2013 Jul;114(7):1464-73.
REF 37 Overexpressed microRNA-182 promotes proliferation and invasion in prostate cancer PC-3 cells by down-regulating N-myc downstream regulated gene 1 (NDRG1).PLoS One. 2013 Jul 16;8(7):e68982.
REF 38 miR-182-5p Induced by STAT3 Activation Promotes Glioma Tumorigenesis.Cancer Res. 2016 Jul 15;76(14):4293-304.
REF 39 MicroRNA-182 promotes tumor cell growth by targeting transcription elongation factor A-like 7 in endometrial carcinoma.Cell Physiol Biochem. 2013;32(3):581-90.
REF 40 Upregulated miR-182 increases drug resistance in cisplatin-treated HCC cell by regulating TP53INP1.Gene. 2014 Apr 1;538(2):342-7.
REF 41 TGF- induces miR-182 to sustain NF-B activation in glioma subsets.J Clin Invest. 2012 Oct;122(10):3563-78.
REF 42 A novel recombinant Salmonella vaccine enhances the innate immunity of NK cells against acute myeloid leukaemia cells Kasumi-1 in vitro.Cell Biol Int. 2013 Dec;37(12):1320-9.
REF 43 MiR-182 and miR-203 induce mesenchymal to epithelial transition and self-sufficiency of growth signals via repressing SNAI2 in prostate cells.Int J Cancer. 2013 Aug 1;133(3):544-55.
REF 44 miR-182 Regulates Metabolic Homeostasis by Modulating Glucose Utilization in Muscle.Cell Rep. 2016 Jul 19;16(3):757-68.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.