miRNA General Information
miRNA Mature ID	hsa-miR-29a-5p
miRNA Stemloop AC	MI0000087
miRNA Stemloop ID	hsa-mir-29a
Sequence	acugauuucuuuugguguucag
TTD Target(s) Regulated by This miRNA	Glycogen synthase kinase-3 beta (GSK-3B)	Clinical trial Target	Target Info	[1]
	Dickkopf-related protein 1 (DKK1)	Clinical trial Target	Target Info	[1]
	Histone deacetylase 9 (HDAC9)	Patented-recorded Target	Target Info	[2]
	Phosphatase and tensin homolog (PTEN)	Literature-reported Target	Target Info	[3]
	Osteonectin (SPARC)	Literature-reported Target	Target Info	[4]
Protein(s) Regulated by This miRNA	Bile salt sulfotransferase	Regulated Protein	ST2A1_HUMAN	[5]
	Collagen alpha-1(III) chain	Regulated Protein	CO3A1_HUMAN	[4]
	TGF-beta-activated kinase 1 and MAP3K7-binding protein 1	Regulated Protein	TAB1_HUMAN	[7]
References
REF 1	miR-29a modulates tumor necrosis factor--induced osteogenic inhibition by targeting Wnt antagonists. Dev Growth Differ. 2015 Apr;57(3):264-73.
REF 2	TGF-1 Reduces miR-29a Expression to Promote Tumorigenicity and Metastasis of Cholangiocarcinoma by Targeting HDAC4. PLoS One. 2015 Oct 6;10(10):e0136703.
REF 3	MiR-29a Regulates Radiosensitivity in Human Intestinal Cells by Targeting PTEN Gene. Radiat Res. 2016 Sep;186(3):292-301.
REF 4	miR-29a/b enhances cell migration and invasion in nasopharyngeal carcinoma progression by regulating SPARC and COL3A1 gene expression. PLoS One. 2015 Mar 18;10(3):e0120969.
REF 5	MicroRNA29a regulates IL-33-mediated tissue remodelling in tendon disease.Nat Commun. 2015 Apr 10;6:6774.
REF 6	miR-29a/b enhances cell migration and invasion in nasopharyngeal carcinoma progression by regulating SPARC and COL3A1 gene expression. PLoS One. 2015 Mar 18;10(3):e0120969.
REF 7	MiR-29a reduces TIMP-1 production by dermal fibroblasts via targeting TGF- activated kinase 1 binding protein 1, implications for systemic sclerosis.PLoS One. 2014 Dec 30;9(12):e115596.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.