miRNA General Information
miRNA Mature ID hsa-miR-10a-5p
miRNA Stemloop AC MI0000266
miRNA Stemloop ID hsa-mir-10a
Sequence uacccuguagauccgaauuugug
TTD Target(s) Regulated by This miRNA PI3-kinase gamma (PIK3CG) Successful Target Target Info [1]
Interleukin-12 alpha (IL12A) Successful Target Target Info [2]
Interleukin-23 (IL23) Successful Target Target Info [2]
Matrix metalloproteinase-14 (MMP-14) Clinical trial Target Target Info [3]
Endothelial plasminogen activator inhibitor (SERPINE1) Clinical trial Target Target Info [4]
Brain-derived neurotrophic factor (BDNF) Clinical trial Target Target Info [5]
Platelet glycoprotein Ib alpha (CD42b) Clinical trial Target Target Info [6]
Pattern recognition receptor NOD2 (NOD2) Clinical trial Target Target Info [2]
JNK-interacting protein 1 peptide (pepJIP1) Patented-recorded Target Target Info [7]
Ephrin type-A receptor 4 (EPHA4) Literature-reported Target Target Info [8]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [9]
TGF-beta-activated kinase 1 (MAP3K7) Literature-reported Target Target Info [10]
AN1-type zinc finger protein 5 (ZFAND5) Literature-reported Target Target Info [11]
T-lymphoma invasion and metastasis 1 (TIAM1) Literature-reported Target Target Info [11]
Protein(s) Regulated by This miRNA Actin, cytoplasmic 2 Regulated Protein [11]
B-cell lymphoma 6 protein Regulated Protein [13]
Bcl-2-like protein 11 Regulated Protein [14]
Consortin Regulated Protein [11]
F-box/WD repeat-containing protein 1A Regulated Protein [10]
Homeobox protein Hox-A1 Regulated Protein [16]
Neural cell adhesion molecule L1-like protein Regulated Protein [17]
Nuclear receptor corepressor 2 Regulated Protein [18]
Ras-related protein Rap-2a Regulated Protein [11]
Serine/arginine-rich splicing factor 1 Regulated Protein [19]
Transformer-2 protein homolog beta Regulated Protein [19]
Upstream stimulatory factor 2 Regulated Protein [20]
References
REF 1 MicroRNA-10a controls airway smooth muscle cell proliferation via direct targeting of the PI3 kinase pathway. FASEB J. 2014 May;28(5):2347-57.
REF 2 miR-10a inhibits dendritic cell activation and Th1/Th17 cell immune responses in IBD. Gut. 2015 Nov;64(11):1755-64.
REF 3 miR-10a suppresses colorectal cancer metastasis by modulating the epithelial-to-mesenchymal transition and anoikis. Cell Death Dis. 2017 Apr 6;8(4):e2739.
REF 4 MiR-10a and miR-181c regulate collagen type I generation in hypertrophic scars by targeting PAI-1 and uPA. FEBS Lett. 2015 Jan 30;589(3):380-9.
REF 5 Conserved miR-10 family represses proliferation and induces apoptosis in ovarian granulosa cells. Sci Rep. 2017 Jan 23;7:41304.
REF 6 MicroRNAs 10a and 10b Regulate the Expression of Human Platelet Glycoprotein Ib for Normal Megakaryopoiesis. Int J Mol Sci. 2016 Nov 9;17(11). pii: E1873.
REF 7 Direct targeting of MAPK8IP1 by miR-10a-5p is a major mechanism for gastric cancer metastasis. Oncol Lett. 2017 Mar;13(3):1131-1136.
REF 8 MicroRNA-10a is involved in the metastatic process by regulating Eph tyrosine kinase receptor A4-mediated epithelial-mesenchymal transition and adhesion in hepatoma cells. Hepatology. 2013 Feb;57(2):667-77.
REF 9 TGF--induced miR10a/b expression promotes human glioma cell migration by targeting PTEN. Mol Med Rep. 2013 Dec;8(6):1741-6.
REF 10 MicroRNA-10a regulation of proinflammatory phenotype in athero-susceptible endothelium in vivo and in vitro. Proc Natl Acad Sci U S A. 2010 Jul 27;107(30):13450-5.
REF 11 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 12 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 13 CD4+ T cells from patients with acute myeloid leukemia inhibit the proliferation of bone marrow-derived mesenchymal stem cells by secretion of miR-10a.J Cancer Res Clin Oncol. 2016 Apr;142(4):733-40.
REF 14 A SNP in pri-miR-10a is associated with recurrent spontaneous abortion in a Han-Chinese population.Oncotarget. 2016 Feb 16;7(7):8208-22.
REF 15 MicroRNA-10a regulation of proinflammatory phenotype in athero-susceptible endothelium in vivo and in vitro. Proc Natl Acad Sci U S A. 2010 Jul 27;107(30):13450-5.
REF 16 MicroRNA fingerprints during human megakaryocytopoiesis.Proc Natl Acad Sci U S A. 2006 Mar 28;103(13):5078-83.
REF 17 MicroRNA-10a targets CHL1 and promotes cell growth, migration and invasion in human cervical cancer cells.Cancer Lett. 2012 Nov 28;324(2):186-96.
REF 18 MicroRNAs 10a and 10b are potent inducers of neuroblastoma cell differentiation through targeting of nuclear receptor corepressor 2.Cell Death Differ. 2011 Jul;18(7):1089-98.
REF 19 MicroRNAs-10a and -10b contribute to retinoic acid-induced differentiation of neuroblastoma cells and target the alternative splicing regulatory factor SFRS1 (SF2/ASF).J Biol Chem. 2011 Feb 11;286(6):4150-64.
REF 20 Down-regulation of hsa-miR-10a in chronic myeloid leukemia CD34+ cells increases USF2-mediated cell growth.Mol Cancer Res. 2008 Dec;6(12):1830-40.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.