miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-10a-5p | ||||
miRNA Stemloop AC | MI0000266 | ||||
miRNA Stemloop ID | hsa-mir-10a | ||||
Sequence | uacccuguagauccgaauuugug | ||||
TTD Target(s) Regulated by This miRNA | PI3-kinase gamma (PIK3CG) | Successful Target | Target Info | [1] | |
Interleukin-12 alpha (IL12A) | Successful Target | Target Info | [2] | ||
Interleukin-23 (IL23) | Successful Target | Target Info | [2] | ||
Matrix metalloproteinase-14 (MMP-14) | Clinical trial Target | Target Info | [3] | ||
Endothelial plasminogen activator inhibitor (SERPINE1) | Clinical trial Target | Target Info | [4] | ||
Brain-derived neurotrophic factor (BDNF) | Clinical trial Target | Target Info | [5] | ||
Platelet glycoprotein Ib alpha (CD42b) | Clinical trial Target | Target Info | [6] | ||
Pattern recognition receptor NOD2 (NOD2) | Clinical trial Target | Target Info | [2] | ||
JNK-interacting protein 1 peptide (pepJIP1) | Patented-recorded Target | Target Info | [7] | ||
Ephrin type-A receptor 4 (EPHA4) | Literature-reported Target | Target Info | [8] | ||
Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [9] | ||
TGF-beta-activated kinase 1 (MAP3K7) | Literature-reported Target | Target Info | [10] | ||
AN1-type zinc finger protein 5 (ZFAND5) | Literature-reported Target | Target Info | [11] | ||
T-lymphoma invasion and metastasis 1 (TIAM1) | Literature-reported Target | Target Info | [11] | ||
Protein(s) Regulated by This miRNA | Actin, cytoplasmic 2 | Regulated Protein | [11] | ||
B-cell lymphoma 6 protein | Regulated Protein | [13] | |||
Bcl-2-like protein 11 | Regulated Protein | [14] | |||
Consortin | Regulated Protein | [11] | |||
F-box/WD repeat-containing protein 1A | Regulated Protein | [10] | |||
Homeobox protein Hox-A1 | Regulated Protein | [16] | |||
Neural cell adhesion molecule L1-like protein | Regulated Protein | [17] | |||
Nuclear receptor corepressor 2 | Regulated Protein | [18] | |||
Ras-related protein Rap-2a | Regulated Protein | [11] | |||
Serine/arginine-rich splicing factor 1 | Regulated Protein | [19] | |||
Transformer-2 protein homolog beta | Regulated Protein | [19] | |||
Upstream stimulatory factor 2 | Regulated Protein | [20] | |||
References | |||||
REF 1 | MicroRNA-10a controls airway smooth muscle cell proliferation via direct targeting of the PI3 kinase pathway. FASEB J. 2014 May;28(5):2347-57. | ||||
REF 2 | miR-10a inhibits dendritic cell activation and Th1/Th17 cell immune responses in IBD. Gut. 2015 Nov;64(11):1755-64. | ||||
REF 3 | miR-10a suppresses colorectal cancer metastasis by modulating the epithelial-to-mesenchymal transition and anoikis. Cell Death Dis. 2017 Apr 6;8(4):e2739. | ||||
REF 4 | MiR-10a and miR-181c regulate collagen type I generation in hypertrophic scars by targeting PAI-1 and uPA. FEBS Lett. 2015 Jan 30;589(3):380-9. | ||||
REF 5 | Conserved miR-10 family represses proliferation and induces apoptosis in ovarian granulosa cells. Sci Rep. 2017 Jan 23;7:41304. | ||||
REF 6 | MicroRNAs 10a and 10b Regulate the Expression of Human Platelet Glycoprotein Ib for Normal Megakaryopoiesis. Int J Mol Sci. 2016 Nov 9;17(11). pii: E1873. | ||||
REF 7 | Direct targeting of MAPK8IP1 by miR-10a-5p is a major mechanism for gastric cancer metastasis. Oncol Lett. 2017 Mar;13(3):1131-1136. | ||||
REF 8 | MicroRNA-10a is involved in the metastatic process by regulating Eph tyrosine kinase receptor A4-mediated epithelial-mesenchymal transition and adhesion in hepatoma cells. Hepatology. 2013 Feb;57(2):667-77. | ||||
REF 9 | TGF--induced miR10a/b expression promotes human glioma cell migration by targeting PTEN. Mol Med Rep. 2013 Dec;8(6):1741-6. | ||||
REF 10 | MicroRNA-10a regulation of proinflammatory phenotype in athero-susceptible endothelium in vivo and in vitro. Proc Natl Acad Sci U S A. 2010 Jul 27;107(30):13450-5. | ||||
REF 11 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
REF 12 | MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676. | ||||
REF 13 | CD4+ T cells from patients with acute myeloid leukemia inhibit the proliferation of bone marrow-derived mesenchymal stem cells by secretion of miR-10a.J Cancer Res Clin Oncol. 2016 Apr;142(4):733-40. | ||||
REF 14 | A SNP in pri-miR-10a is associated with recurrent spontaneous abortion in a Han-Chinese population.Oncotarget. 2016 Feb 16;7(7):8208-22. | ||||
REF 15 | MicroRNA-10a regulation of proinflammatory phenotype in athero-susceptible endothelium in vivo and in vitro. Proc Natl Acad Sci U S A. 2010 Jul 27;107(30):13450-5. | ||||
REF 16 | MicroRNA fingerprints during human megakaryocytopoiesis.Proc Natl Acad Sci U S A. 2006 Mar 28;103(13):5078-83. | ||||
REF 17 | MicroRNA-10a targets CHL1 and promotes cell growth, migration and invasion in human cervical cancer cells.Cancer Lett. 2012 Nov 28;324(2):186-96. | ||||
REF 18 | MicroRNAs 10a and 10b are potent inducers of neuroblastoma cell differentiation through targeting of nuclear receptor corepressor 2.Cell Death Differ. 2011 Jul;18(7):1089-98. | ||||
REF 19 | MicroRNAs-10a and -10b contribute to retinoic acid-induced differentiation of neuroblastoma cells and target the alternative splicing regulatory factor SFRS1 (SF2/ASF).J Biol Chem. 2011 Feb 11;286(6):4150-64. | ||||
REF 20 | Down-regulation of hsa-miR-10a in chronic myeloid leukemia CD34+ cells increases USF2-mediated cell growth.Mol Cancer Res. 2008 Dec;6(12):1830-40. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.