miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-130a-3p | ||||
| miRNA Stemloop AC | MI0000448 | ||||
| miRNA Stemloop ID | hsa-mir-130a | ||||
| Sequence | cagugcaauguuaaaagggcau | ||||
| TTD Target(s) Regulated by This miRNA | Estrogen receptor (ESR) | Successful Target | Target Info | [1] | |
| Platelet-derived growth factor receptor alpha (PDGFRA) | Successful Target | Target Info | [2] | ||
| Peroxisome proliferator-activated receptor alpha (PPARA) | Successful Target | Target Info | [3] | ||
| Peroxisome proliferator-activated receptor gamma (PPAR-gamma) | Successful Target | Target Info | [4] | ||
| Proto-oncogene c-Met (MET) | Successful Target | Target Info | [5] | ||
| Amyloid beta A4 protein (APP) | Successful Target | Target Info | [6] | ||
| Tumor necrosis factor (TNF) | Successful Target | Target Info | [7] | ||
| Low-density lipoprotein receptor (LDL-R) | Successful Target | Target Info | [8] | ||
| Transforming growth factor beta 1 (TGFB1) | Successful Target | Target Info | [9] | ||
| Interleukin-18 (IL18) | Clinical trial Target | Target Info | [9] | ||
| Macrophage colony-stimulating factor 1 (CSF1) | Clinical trial Target | Target Info | [10] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [8] | ||
| X-linked inhibitor of apoptosis protein (XIAP) | Clinical trial Target | Target Info | [11] | ||
| Gap junction alpha-1 protein (GJA1) | Clinical trial Target | Target Info | [12] | ||
| Delta-like protein 4 (DLL4) | Clinical trial Target | Target Info | [13] | ||
| Kruppel like factor 4 (KLF4) | Clinical trial Target | Target Info | [14] | ||
| Activin receptor-like kinase 2 (ALK-2) | Clinical trial Target | Target Info | [15] | ||
| Bone morphogenetic protein receptor (BMPR2) | Literature-reported Target | Target Info | [5] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [16] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [17] | ||
| Autophagy-related 2B (ATG2B) | Literature-reported Target | Target Info | [18] | ||
| Homeobox protein Hox-A5 (HOXA5) | Literature-reported Target | Target Info | [10] | ||
| Methyl cpg binding protein 2 (MECP2) | Clinical trial Target | Target Info | [19] | ||
| Runt-related transcription factor 3 (RUNX3) | Literature-reported Target | Target Info | [20] | ||
| Protein(s) Regulated by This miRNA | Ataxin-1 | Regulated Protein | [21] | ||
| Dynamin-2 | Regulated Protein | [5] | |||
| Homeobox protein Hox-A10 | Regulated Protein | [14] | |||
| Homeobox protein MOX-2 | Regulated Protein | [24] | |||
| Interferon-induced transmembrane protein 1 | Regulated Protein | [25] | |||
| Mitogen-activated protein kinase kinase kinase 12 | Regulated Protein | [26] | |||
| Mothers against decapentaplegic homolog 4 | Regulated Protein | [27] | |||
| Mothers against decapentaplegic homolog 5 | Regulated Protein | [5] | |||
| Peroxisome proliferator-activated receptor gamma coactivator 1-alpha | Regulated Protein | [28] | |||
| Protachykinin-1 | Regulated Protein | [29] | |||
| Ras-related protein Rab-5A | Regulated Protein | [5] | |||
| Ras-related protein Rab-5A | Regulated Protein | [30] | |||
| SLAIN motif-containing protein 1 | Regulated Protein | [31] | |||
| Transcription factor MafB | Regulated Protein | [32] | |||
| References | |||||
| REF 1 | The hepatitis B virus-associated estrogen receptor alpha (ERalpha) was regulated by microRNA-130a in HepG2.2.15 human hepatocellular carcinoma cells. Acta Biochim Biophys Sin (Shanghai). 2011 Aug;43(8):640-6. | ||||
| REF 2 | The Etv2-miR-130a Network Regulates Mesodermal Specification. Cell Rep. 2015 Nov 3;13(5):915-23. | ||||
| REF 3 | Systems-level regulation of microRNA networks by miR-130/301 promotes pulmonary hypertension. J Clin Invest. 2014 Aug;124(8):3514-28. | ||||
| REF 4 | miR-130 suppresses adipogenesis by inhibiting peroxisome proliferator-activated receptor gamma expression. Mol Cell Biol. 2011 Feb;31(4):626-38. | ||||
| REF 5 | MicroRNA expression profiling in HCV-infected human hepatoma cells identifies potential anti-viral targets induced by interferon-. PLoS One. 2013;8(2):e55733. | ||||
| REF 6 | MicroRNA regulation of Alzheimer's Amyloid precursor protein expression. Neurobiol Dis. 2009 Mar;33(3):422-8. | ||||
| REF 7 | NF-B-modulated miR-130a targets TNF- in cervical cancer cells. J Transl Med. 2014 Jun 1;12:155. | ||||
| REF 8 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 9 | Reduced MIR130A is involved in primary immune thrombocytopenia via targeting TGFB1 and IL18. Br J Haematol. 2014 Sep;166(5):767-73. | ||||
| REF 10 | Prediction of mammalian microRNA targets. Cell. 2003 Dec 26;115(7):787-98. | ||||
| REF 11 | Downregulation of miR-130a contributes to cisplatin resistance in ovarian cancer cells by targeting X-linked inhibitor of apoptosis (XIAP) directly. Acta Biochim Biophys Sin (Shanghai). 2013 Dec;45(12):995-1001. | ||||
| REF 12 | Downregulation of connexin43 by microRNA-130a in cardiomyocytes results in cardiac arrhythmias. J Mol Cell Cardiol. 2014 Sep;74:53-63. | ||||
| REF 13 | MicroRNA-30a promotes chondrogenic differentiation of mesenchymal stem cells through inhibiting Delta-like 4 expression. Life Sci. 2016 Mar 1;148:220-8. | ||||
| REF 14 | Expression profiling of cytogenetically normal acute myeloid leukemia identifies microRNAs that target genes involved in monocytic differentiation. Am J Hematol. 2011 Jan;86(1):2-11. | ||||
| REF 15 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
| REF 16 | Nuclear factor-B-dependent microRNA-130a upregulation promotes cervical cancer cell growth by targeting phosphatase and tensin homolog. Arch Biochem Biophys. 2016 May 15;598:57-65. | ||||
| REF 17 | MicroRNA-130a associates with ribosomal protein L11 to suppress c-Myc expression in response to UV irradiation. Oncotarget. 2015 Jan 20;6(2):1101-14. | ||||
| REF 18 | miRNA-130a targets ATG2B and DICER1 to inhibit autophagy and trigger killing of chronic lymphocytic leukemia cells. Cancer Res. 2012 Apr 1;72(7):1763-72. | ||||
| REF 19 | MiR-130a regulates neurite outgrowth and dendritic spine density by targeting MeCP2. Protein Cell. 2016 Jul;7(7):489-500. | ||||
| REF 20 | Upregulated miR-130a increases drug resistance by regulating RUNX3 and Wnt signaling in cisplatin-treated HCC cell. Biochem Biophys Res Commun. 2012 Aug 24;425(2):468-72. | ||||
| REF 21 | miR-19, miR-101 and miR-130 co-regulate ATXN1 levels to potentially modulate SCA1 pathogenesis.Nat Neurosci. 2008 Oct;11(10):1137-9. | ||||
| REF 22 | MicroRNA expression profiling in HCV-infected human hepatoma cells identifies potential anti-viral targets induced by interferon-. PLoS One. 2013;8(2):e55733. | ||||
| REF 23 | Expression profiling of cytogenetically normal acute myeloid leukemia identifies microRNAs that target genes involved in monocytic differentiation. Am J Hematol. 2011 Jan;86(1):2-11. | ||||
| REF 24 | Regulation of angiogenesis through a microRNA (miR-130a) that down-regulates antiangiogenic homeobox genes GAX and HOXA5. Blood. 2008 Feb 1;111(3):1217-26. | ||||
| REF 25 | Hepatitis C virus infection modulates expression of interferon stimulatory gene IFITM1 by upregulating miR-130A.J Virol. 2012 Sep;86(18):10221-5. | ||||
| REF 26 | MicroRNA-130a Targets MAP3K12 to Modulate Diabetic Endothelial Progenitor Cell Function.Cell Physiol Biochem. 2015;36(2):712-26. | ||||
| REF 27 | MiR-130a-3p regulates cell migration and invasion via inhibition of Smad4 in gemcitabine resistant hepatoma cells.J Exp Clin Cancer Res. 2016 Jan 27;35:19. | ||||
| REF 28 | MicroRNA-130a can inhibit hepatitis B virus replication via targeting PGC1 and PPAR.RNA. 2015 Mar;21(3):385-400. | ||||
| REF 29 | MicroRNAs regulate synthesis of the neurotransmitter substance P in human mesenchymal stem cell-derived neuronal cells.Proc Natl Acad Sci U S A. 2007 Sep 25;104(39):15484-9. | ||||
| REF 30 | MicroRNA-130a inhibits cell proliferation, invasion and migration in human breast cancer by targeting the RAB5A. Int J Clin Exp Pathol. 2015 Jan 1;8(1):384-93. | ||||
| REF 31 | miR-130a activates apoptotic signaling through activation of caspase-8 in taxane-resistant prostate cancer cells.Prostate. 2015 Oct;75(14):1568-78. | ||||
| REF 32 | MicroRNA fingerprints during human megakaryocytopoiesis.Proc Natl Acad Sci U S A. 2006 Mar 28;103(13):5078-83. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.