miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-20b-5p | ||||
| miRNA Stemloop AC | MI0001519 | ||||
| miRNA Stemloop ID | hsa-mir-20b | ||||
| Sequence | caaagugcucauagugcagguag | ||||
| TTD Target(s) Regulated by This miRNA | Estrogen receptor (ESR) | Successful Target | Target Info | [1] | |
| Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [2] | ||
| Peroxisome proliferator-activated receptor gamma (PPAR-gamma) | Successful Target | Target Info | [3] | ||
| Signal transducer and activator of transcription 3 (STAT3) | Successful Target | Target Info | [4] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [5] | ||
| Cyclin-dependent kinase 2 (CDK2) | Clinical trial Target | Target Info | [2] | ||
| Ephrin type-B receptor 4 (EPHB4) | Clinical trial Target | Target Info | [6] | ||
| RAC-gamma serine/threonine-protein kinase (AKT3) | Successful Target | Target Info | [7] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [8] | ||
| Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [4] | ||
| Stress-activated protein kinase JNK2 (JNK2) | Preclinical Target | Target Info | [9] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [10] | ||
| LIM domain kinase-1 (LIMK-1) | Literature-reported Target | Target Info | [9] | ||
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [11] | ||
| Protein(s) Regulated by This miRNA | AT-rich interactive domain-containing protein 4B | Regulated Protein | [12] | ||
| BMP and activin membrane-bound inhibitor homolog | Regulated Protein | [3] | |||
| Breast cancer type 1 susceptibility protein | Regulated Protein | [14] | |||
| Cysteine-rich motor neuron 1 protein | Regulated Protein | [3] | |||
| E3 ubiquitin-protein ligase MYLIP | Regulated Protein | [12] | |||
| Ephrin-B2 | Regulated Protein | [6] | |||
| Frizzled-6 | Regulated Protein | [16] | |||
| Homeodomain-interacting protein kinase 3 | Regulated Protein | [12] | |||
| Krueppel-like factor 6 | Regulated Protein | [17] | |||
| Mucin-17 | Regulated Protein | [18] | |||
| RB1-inducible coiled-coil protein 1 | Regulated Protein | [19] | |||
| References | |||||
| REF 1 | The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47. | ||||
| REF 2 | MicroRNA-20b inhibits the proliferation, migration and invasion of bladder cancer EJells via the targeting of cellycle regulation and Sp-1-mediated MMP-2 expression. Oncol Rep. 2015 Sep;34(3):1605-12. | ||||
| REF 3 | miRNA-mediated functional changes through co-regulating function related genes. PLoS One. 2010 Oct 22;5(10):e13558. | ||||
| REF 4 | miR-20b modulates VEGF expression by targeting HIF-1 alpha and STAT3 in MCF-7 breast cancer cells. J Cell Physiol. 2010 Jul;224(1):242-9. | ||||
| REF 5 | Clinicopathological Significance of MicroRNA-20b Expression in Hepatocellular Carcinoma and Regulation of HIF-1 and VEGF Effect on Cell Biological Behaviour. Dis Markers. 2015;2015:325176. | ||||
| REF 6 | Preeclampsia up-regulates angiogenesis-associated microRNA (i.e., miR-17, -20a, and -20b) that target ephrin-B2 and EPHB4 in human placenta. J Clin Endocrinol Metab. 2012 Jun;97(6):E1051-9. | ||||
| REF 7 | MiR-20b targets AKT3 and modulates vascular endothelial growth factor-mediated changes in diabetic retinopathy. Acta Biochim Biophys Sin (Shanghai). 2016 Aug;48(8):732-40. | ||||
| REF 8 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 9 | The miR-17 family links p63 protein to MAPK signaling to promote the onset of human keratinocyte differentiation. PLoS One. 2012;7(9):e45761. | ||||
| REF 10 | EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21. | ||||
| REF 11 | MicroRNAs in the miR-106b family regulate p21/CDKN1A and promote cell cycle progression. Mol Cell Biol. 2008 Apr;28(7):2167-74. | ||||
| REF 12 | Oncogenic potential of the miR-106-363 cluster and its implication in human T-cell leukemia.Cancer Res. 2007 Jun 15;67(12):5699-707. | ||||
| REF 13 | miRNA-mediated functional changes through co-regulating function related genes. PLoS One. 2010 Oct 22;5(10):e13558. | ||||
| REF 14 | Crucial role for early growth response-1 in the transcriptional regulation of miR-20b in breast cancer. Oncotarget. 2013 Sep;4(9):1373-87. | ||||
| REF 15 | Preeclampsia up-regulates angiogenesis-associated microRNA (i.e., miR-17, -20a, and -20b) that target ephrin-B2 and EPHB4 in human placenta. J Clin Endocrinol Metab. 2012 Jun;97(6):E1051-9. | ||||
| REF 16 | A regulatory circuit of miR-125b/miR-20b and Wnt signalling controls glioblastoma phenotypes through FZD6-modulated pathways.Nat Commun. 2016 Oct 4;7:12885. | ||||
| REF 17 | Vitamin D manipulates miR-181c, miR-20b and miR-15a in human umbilical vein endothelial cells exposed to a diabetic-like environment.Cardiovasc Diabetol. 2014 Jan 7;13:8. | ||||
| REF 18 | DNA methylation and histone H3-K9 modifications contribute to MUC17 expression.Glycobiology. 2011 Feb;21(2):247-56. | ||||
| REF 19 | MiR-20a and miR-20b negatively regulate autophagy by targeting RB1CC1/FIP200 in breast cancer cells.Life Sci. 2016 Feb 15;147:143-52. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.