miRNA General Information
miRNA Mature ID hsa-miR-200c-5p
miRNA Stemloop AC MI0000650
miRNA Stemloop ID hsa-mir-200c
Sequence cgucuuacccagcaguguuugg
TTD Target(s) Regulated by This miRNA Cytochrome P450 1B1 (CYP1B1) Clinical trial Target Target Info [1]
Hypoxia-inducible factor 1 alpha (HIF-1A) Clinical trial Target Target Info [2]
Phosphatase and tensin homolog (PTEN) Literature-reported Target Target Info [3]
Polycomb complex protein BMI-1 (BMI1) Clinical trial Target Target Info [4]
Epithelial cadherin (CDH1) Literature-reported Target Target Info [3]
References
REF 1 Loss of miR-200c up-regulates CYP1B1 and confers docetaxel resistance in renal cell carcinoma. Oncotarget. 2015 Apr 10;6(10):7774-87.
REF 2 Identification of Dormancy-Associated MicroRNAs for the Design of Osteosarcoma-Targeted Dendritic Polyglycerol Nanopolyplexes. ACS Nano. 2016 Feb 23;10(2):2028-45.
REF 3 The Effect of miR-200c Inhibition on Chemosensitivity (5- FluoroUracil) in Colorectal Cancer. Pathol Oncol Res. 2018 Jan;24(1):145-151.
REF 4 miR-200c inhibits invasion, migration and proliferation of bladder cancer cells through down-regulation of BMI-1 and E2F3. J Transl Med. 2014 Nov 4;12:305.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.