miRNA Details
miRNA General Information | |||||
---|---|---|---|---|---|
miRNA Mature ID | hsa-miR-200c-5p | ||||
miRNA Stemloop AC | MI0000650 | ||||
miRNA Stemloop ID | hsa-mir-200c | ||||
Sequence | cgucuuacccagcaguguuugg | ||||
TTD Target(s) Regulated by This miRNA | Cytochrome P450 1B1 (CYP1B1) | Clinical trial Target | Target Info | [1] | |
Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [2] | ||
Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [3] | ||
Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [4] | ||
Epithelial cadherin (CDH1) | Literature-reported Target | Target Info | [3] | ||
References | |||||
REF 1 | Loss of miR-200c up-regulates CYP1B1 and confers docetaxel resistance in renal cell carcinoma. Oncotarget. 2015 Apr 10;6(10):7774-87. | ||||
REF 2 | Identification of Dormancy-Associated MicroRNAs for the Design of Osteosarcoma-Targeted Dendritic Polyglycerol Nanopolyplexes. ACS Nano. 2016 Feb 23;10(2):2028-45. | ||||
REF 3 | The Effect of miR-200c Inhibition on Chemosensitivity (5- FluoroUracil) in Colorectal Cancer. Pathol Oncol Res. 2018 Jan;24(1):145-151. | ||||
REF 4 | miR-200c inhibits invasion, migration and proliferation of bladder cancer cells through down-regulation of BMI-1 and E2F3. J Transl Med. 2014 Nov 4;12:305. |
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.