miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-92a-1-5p | ||||
| miRNA Stemloop AC | MI0000093 | ||||
| miRNA Stemloop ID | hsa-mir-92a-1 | ||||
| Sequence | agguugggaucgguugcaaugcu | ||||
| TTD Target(s) Regulated by This miRNA | Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [1] | |
| Apoptosis mediating surface antigen FAS (FAS) | Clinical trial Target | Target Info | [1] | ||
| Interleukin-1 alpha (IL1A) | Clinical trial Target | Target Info | [2] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [3] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [1] | ||
| Protein(s) Regulated by This miRNA | Cytokine-inducible SH2-containing protein | Regulated Protein | [3] | ||
| Krueppel-like factor 2 | Regulated Protein | [5] | |||
| Ras GTPase-activating-like protein IQGAP2 | Regulated Protein | [6] | |||
| References | |||||
| REF 1 | Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63. | ||||
| REF 2 | miR-92a Corrects CD34+ Cell Dysfunction in Diabetes by Modulating Core Circadian Genes Involved in Progenitor Differentiation. Diabetes. 2015 Dec;64(12):4226-37. | ||||
| REF 3 | Specific alterations of the microRNA transcriptome and global network structure in colorectal cancer after treatment with MAPK/ERK inhibitors. J Mol Med (Berl). 2012 Dec;90(12):1421-38. | ||||
| REF 4 | Specific alterations of the microRNA transcriptome and global network structure in colorectal cancer after treatment with MAPK/ERK inhibitors. J Mol Med (Berl). 2012 Dec;90(12):1421-38. | ||||
| REF 5 | High concentrations of uric acid inhibit angiogenesis via regulation of the Krpel-like factor 2-vascular endothelial growth factor-A axis by miR-92a.Circ J. 2015;79(11):2487-98. | ||||
| REF 6 | Integrated genomic profiling identifies microRNA-92a regulation of IQGAP2 in locally advanced rectal cancer.Genes Chromosomes Cancer. 2016 Apr;55(4):311-321. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.