miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-142-5p | ||||
| miRNA Stemloop AC | MI0000458 | ||||
| miRNA Stemloop ID | hsa-mir-142 | ||||
| Sequence | cauaaaguagaaagcacuacu | ||||
| TTD Target(s) Regulated by This miRNA | NAD-dependent deacetylase sirtuin-1 (SIRT1) | Clinical trial Target | Target Info | [1] | |
| Transforming growth factor beta 2 (TGFB2) | Clinical trial Target | Target Info | [2] | ||
| Nuclear factor erythroid 2-related factor 2 (Nrf2) | Successful Target | Target Info | [3] | ||
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [4] | ||
| Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [5] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [6] | ||
| Ras-related C3 botulinum toxin substrate 1 (RAC1) | Literature-reported Target | Target Info | [7] | ||
| Beclin-1 (BECN1) | Literature-reported Target | Target Info | [8] | ||
| Suppressor of cytokine signaling 1 (SOCS1) | Literature-reported Target | Target Info | [9] | ||
| Mothers against decapentaplegic homolog 3 (SMAD3) | Preclinical Target | Target Info | [10] | ||
| Protein(s) Regulated by This miRNA | Claudin-1 | Regulated Protein | [11] | ||
| Insulin-like growth factor 2 mRNA-binding protein 3 | Regulated Protein | [12] | |||
| Transcription regulator protein BACH2 | Regulated Protein | [13] | |||
| Tumor protein p53-inducible nuclear protein 1 | Regulated Protein | [14] | |||
| Zinc finger E-box-binding homeobox 1 | Regulated Protein | [15] | |||
| References | |||||
| REF 1 | Up-regulation of microRNA-142 in simian immunodeficiency virus encephalitis leads to repression of sirtuin1. FASEB J. 2013 Sep;27(9):3720-9. | ||||
| REF 2 | Upregulation of miR-142-5p in atherosclerotic plaques and regulation of oxidized low-density lipoprotein-induced apoptosis in macrophages. Mol Med Rep. 2015 May;11(5):3229-34. | ||||
| REF 3 | Identification of novel microRNAs in post-transcriptional control of Nrf2 expression and redox homeostasis in neuronal, SH-SY5Y cells. PLoS One. 2012;7(12):e51111. | ||||
| REF 4 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 5 | MiR-142 modulates human pancreatic cancer proliferation and invasion by targeting hypoxia-inducible factor 1 (HIF-1) in the tumor microenvironments. Biol Open. 2017 Feb 15;6(2):252-259. | ||||
| REF 6 | Epstein-Barr Virus (EBV)-BamHI-A Rightward Transcript (BART)-6 and Cellular MicroRNA-142 Synergistically Compromise Immune Defense of Host Cells in EBV-Positive Burkitt Lymphoma. Med Sci Monit. 2016 Oct 31;22:4114-4120. | ||||
| REF 7 | MiR-142 acts as a tumor suppressor in osteosarcoma cell lines by targeting Rac1. Oncol Rep. 2015 Mar;33(3):1291-9. | ||||
| REF 8 | Mesenchymal Stem Cells Alleviate LPS-Induced Acute Lung Injury in Mice by MiR-142a-5p-Controlled Pulmonary Endothelial Cell Autophagy. Cell Physiol Biochem. 2016;38(1):258-66. | ||||
| REF 9 | miR-142-5p and miR-130a-3p are regulated by IL-4 and IL-13 and control profibrogenic macrophage program. Nat Commun. 2015 Oct 5;6:8523. | ||||
| REF 10 | Rotavirus-induced miR-142-5p elicits proviral milieu by targeting non-canonical transforming growth factor beta signalling and apoptosis in cells. Cell Microbiol. 2016 May;18(5):733-47. | ||||
| REF 11 | MicroRNA-142-5p contributes to Hashimoto's thyroiditis by targeting CLDN1.J Transl Med. 2016 Jun 8;14(1):166. | ||||
| REF 12 | Differentially expressed miRNAs in sepsis-induced acute kidney injury target oxidative stress and mitochondrial dysfunction pathways.PLoS One. 2017 Mar 15;12(3):e0173292. | ||||
| REF 13 | microRNA-142 is upregulated by tumor necrosis factor-alpha and triggers apoptosis in human gingival epithelial cells by repressing BACH2 expression. Am J Transl Res. 2017 Jan 15;9(1):175-183. | ||||
| REF 14 | Overexpression of miR-142-5p and miR-155 in gastric mucosa-associated lymphoid tissue (MALT) lymphoma resistant to Helicobacter pylori eradication.PLoS One. 2012;7(11):e47396. | ||||
| REF 15 | MicroRNA-142 is mutated in about 20% of diffuse large B-cell lymphoma.Cancer Med. 2012 Oct;1(2):141-55. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.