miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-425-5p | ||||
| miRNA Stemloop AC | MI0001448 | ||||
| miRNA Stemloop ID | hsa-mir-425 | ||||
| Sequence | aaugacacgaucacucccguuga | ||||
| TTD Target(s) Regulated by This miRNA | Tyrosine-protein kinase BTK (ATK) | Successful Target | Target Info | [1] | |
| Thyroid hormone receptor beta (THRB) | Successful Target | Target Info | [2] | ||
| Fibroblast growth factor receptor 3 (FGFR3) | Successful Target | Target Info | [3] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [4] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [5] | ||
| Transforming acidic coiled-coil protein 3 (TACC3) | Literature-reported Target | Target Info | [3] | ||
| Protein(s) Regulated by This miRNA | Mothers against decapentaplegic homolog 2 | Regulated Protein | [6] | ||
| Programmed cell death protein 10 | Regulated Protein | [7] | |||
| Transcription factor MafB | Regulated Protein | [3] | |||
| References | |||||
| REF 1 | Targeting BTK through microRNA in chronic lymphocytic leukemia. Blood. 2016 Dec 29;128(26):3101-3112. | ||||
| REF 2 | Epigenetic regulation of thyroid hormone receptor beta in renal cancer. PLoS One. 2014 May 21;9(5):e97624. | ||||
| REF 3 | Downregulation of specific miRNAs in hyperdiploid multiple myeloma mimics the oncogenic effect of IgH translocations occurring in the non-hyperdiploid subtype. Leukemia. 2013 Apr;27(4):925-31. | ||||
| REF 4 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 5 | NF-kappaB-dependent microRNA-425 upregulation promotes gastric cancer cell growth by targeting PTEN upon IL-1 induction. Mol Cancer. 2014 Feb 26;13:40. | ||||
| REF 6 | Enhanced Expression of miR-425 Promotes Esophageal Squamous Cell Carcinoma Tumorigenesis by Targeting SMAD2.J Genet Genomics. 2015 Nov 20;42(11):601-611. | ||||
| REF 7 | Arsenic-induced anti-angiogenesis via miR-425-5p-regulated CCM3.Toxicol Lett. 2016 Jul 8;254:22-31. | ||||
| REF 8 | Downregulation of specific miRNAs in hyperdiploid multiple myeloma mimics the oncogenic effect of IgH translocations occurring in the non-hyperdiploid subtype. Leukemia. 2013 Apr;27(4):925-31. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.