miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-193a-3p | ||||
| miRNA Stemloop AC | MI0000487 | ||||
| miRNA Stemloop ID | hsa-mir-193a | ||||
| Sequence | aacuggccuacaaagucccagu | ||||
| TTD Target(s) Regulated by This miRNA | Erbb2 tyrosine kinase receptor (HER2) | Successful Target | Target Info | [1] | |
| Erbb4 tyrosine kinase receptor (Erbb-4) | Successful Target | Target Info | [2] | ||
| Urokinase-type plasminogen activator (PLAU) | Successful Target | Target Info | [3] | ||
| Matrix metalloproteinase-14 (MMP-14) | Clinical trial Target | Target Info | [4] | ||
| Focal adhesion kinase 1 (FAK) | Clinical trial Target | Target Info | [5] | ||
| Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) | Clinical trial Target | Target Info | [6] | ||
| Transforming growth factor beta 2 (TGFB2) | Clinical trial Target | Target Info | [7] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [3] | ||
| E2F transcription factor 1 (E2F1) | Clinical trial Target | Target Info | [8] | ||
| Large neutral amino acids transporter 1 (SLC7A5) | Literature-reported Target | Target Info | [9] | ||
| Phosphatase and tensin homolog (PTEN) | Literature-reported Target | Target Info | [10] | ||
| Thymidylate synthase (TYMS) | Clinical trial Target | Target Info | [8] | ||
| High mobility group protein B1 (HMGB1) | Literature-reported Target | Target Info | [11] | ||
| Protein(s) Regulated by This miRNA | Hypoxia up-regulated protein 1 | Regulated Protein | [11] | ||
| Proline-rich acidic protein 1 | Regulated Protein | [13] | |||
| Ras-related protein Rab-27B | Regulated Protein | [14] | |||
| Ribosomal protein S6 kinase beta-2 | Regulated Protein | [2] | |||
| Selenoprotein N | Regulated Protein | [3] | |||
| Serine/arginine-rich splicing factor 2 | Regulated Protein | [8] | |||
| Transcription factor E2F6 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | High-throughput screens identify microRNAs essential for HER2 positive breast cancer cell growth. Mol Oncol. 2014 Feb;8(1):93-104. | ||||
| REF 2 | MicroRNA-193a-3p and -5p suppress the metastasis of human non-small-cell lung cancer by downregulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway. Oncogene. 2015 Jan 22;34(4):413-23. | ||||
| REF 3 | Arm Selection Preference of MicroRNA-193a Varies in Breast Cancer. Sci Rep. 2016 Jun 16;6:28176. | ||||
| REF 4 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
| REF 5 | Exploration of tumor-suppressive microRNAs silenced by DNA hypermethylation in oral cancer. Cancer Res. 2008 Apr 1;68(7):2094-105. | ||||
| REF 6 | mir-29 regulates Mcl-1 protein expression and apoptosis. Oncogene. 2007 Sep 13;26(42):6133-40. | ||||
| REF 7 | The aberrantly expressed miR-193b-3p contributes to preeclampsia through regulating transforming growth factor- signaling. Sci Rep. 2016 Jan 29;6:19910. | ||||
| REF 8 | miR-193a-3p is a potential tumor suppressor in malignant pleural mesothelioma. Oncotarget. 2015 Sep 15;6(27):23480-95. | ||||
| REF 9 | XB130, a new adaptor protein, regulates expression of tumor suppressive microRNAs in cancer cells. PLoS One. 2013;8(3):e59057. | ||||
| REF 10 | Downregulation of microRNA-193-3p inhibits tumor proliferation migration and chemoresistance in human gastric cancer by regulating PTEN gene. Tumour Biol. 2016 Jul;37(7):8941-9. | ||||
| REF 11 | miR-193a-3p interaction with HMGB1 downregulates human endothelial cell proliferation and migration. Sci Rep. 2017 Mar 9;7:44137. | ||||
| REF 12 | miR-193a-3p interaction with HMGB1 downregulates human endothelial cell proliferation and migration. Sci Rep. 2017 Mar 9;7:44137. | ||||
| REF 13 | Impaired MicroRNA Processing Facilitates Breast Cancer Cell Invasion by Upregulating Urokinase-Type Plasminogen Activator Expression.Genes Cancer. 2011 Feb;2(2):140-50. | ||||
| REF 14 | MiR-193a-3p and miR-193a-5p suppress the metastasis of human osteosarcoma cells by down-regulating Rab27B and SRR, respectively. Clin Exp Metastasis. 2016 Apr;33(4):359-72. | ||||
| REF 15 | MicroRNA-193a-3p and -5p suppress the metastasis of human non-small-cell lung cancer by downregulating the ERBB4/PIK3R3/mTOR/S6K2 signaling pathway. Oncogene. 2015 Jan 22;34(4):413-23. | ||||
| REF 16 | Arm Selection Preference of MicroRNA-193a Varies in Breast Cancer. Sci Rep. 2016 Jun 16;6:28176. | ||||
| REF 17 | miR-193a-3p is a potential tumor suppressor in malignant pleural mesothelioma. Oncotarget. 2015 Sep 15;6(27):23480-95. | ||||
| REF 18 | Exploration of tumor-suppressive microRNAs silenced by DNA hypermethylation in oral cancer. Cancer Res. 2008 Apr 1;68(7):2094-105. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.