Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T36121 Target Info
Target Name Proto-oncogene c-Myc (MYC)
Synonyms Transcription factor p64; Myc proto-oncogene protein; Class E basic helix-loop-helix protein 39; BHLHE39
Target Type Literature-reported Target
Gene Name MYC
UniProt ID
P01106
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-145-5p by mature miRNA precursor transfection resulted in the decreased protein level of target MYC. [2]
Evidence Score (E-score) 6 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [1]
2 Immunoblot; Luciferase Reporter Assay; qRT-PCR [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Microarray; qRT-PCR; Western Blot [4]
5 qRT-PCR; Luciferase Reporter Assay; Western Blot [5]
6 qRT-PCR; Western Blot [6]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-34a-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target MYC. [2]
Evidence Score (E-score) 6 +
1 Luciferase Reporter Assay [7]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
3 Luciferase Reporter Assay; Western Blot; qRT-PCR; Microarray [9]
4 qRT-PCR; Western Blot [10]
5 qRT-PCR; Western Blot [11]
6 qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-34b-3p miRNA Info
miRNA Mature AC
MIMAT0004676
Sequence caaucacuaacuccacugccau
miRNA Species Homo sapiens
Regulation Mechanism miR-34b transfection decreased C-MYC protein levels. [14]
Evidence Score (E-score) 3 +
1 Immunohistochemistry; qRT-PCR [12]
2 Immunoprecipitation; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [13]
3 Luciferase Reporter Assay; Western Blot [14]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-34c-5p miRNA Info
miRNA Mature AC
MIMAT0000686
Sequence aggcaguguaguuagcugauugc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-34c-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target MYC. [2]
Evidence Score (E-score) 3 +
1 Immunoprecipitation; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [13]
2 Immunoprecipitation; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay [15]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-451a miRNA Info
miRNA Mature AC
MIMAT0001631
Sequence aaaccguuaccauuacugaguu
miRNA Species Homo sapiens
Regulation Mechanism c-Myc is identified as a direct target of miR-451. [16]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [16]
2 Luciferase Reporter Assay [17]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [18]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
miRNA Mature ID hsa-miR-335-5p miRNA Info
miRNA Mature AC
MIMAT0000765
Sequence ucaagagcaauaacgaaaaaugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Microarray [19]
2 Western Blot [20]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-33b-5p miRNA Info
miRNA Mature AC
MIMAT0003301
Sequence gugcauugcuguugcauugc
miRNA Species Homo sapiens
Regulation Mechanism miR-33b negatively regulates c-Myc expression through direct targeting of its 3'UTR in 293T cells. [21]
Evidence Score (E-score) 2 +
1 Immunohistochemistry [21]
2 Immunohistochemistry; qRT-PCR; Western Blot [22]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-34b-5p miRNA Info
miRNA Mature AC
MIMAT0000685
Sequence uaggcagugucauuagcugauug
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-34b-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target MYC. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [15]
2 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-378a-3p miRNA Info
miRNA Mature AC
MIMAT0000732
Sequence acuggacuuggagucagaaggc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [23]
2 Immunoblot; Luciferase Reporter Assay; qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Aromatase (CYP19A1) Target Info
CP19A_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [24]
2 TRAP [25]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-98-5p miRNA Info
miRNA Mature AC
MIMAT0000096
Sequence ugagguaguaaguuguauuguu
miRNA Species Homo sapiens
Regulation Mechanism E2 induced the expression of miR-98 reduced the levels of c-Myc and E2F2 proteins. [27]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Northern Blot; qRT-PCR; ChIP [26]
2 Microarray [27]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aromatase (CYP19A1) Target Info
CP19A_HUMAN
miRNA Mature ID hsa-miR-129-2-3p miRNA Info
miRNA Mature AC
MIMAT0004605
Sequence aagcccuuaccccaaaaagcau
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunoblot; Luciferase Reporter Assay [28]
2 Immunoblot; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-449c-5p miRNA Info
miRNA Mature AC
MIMAT0010251
Sequence uaggcaguguauugcuagcggcugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [29]
2 PAR-CLIP [30]
Representative Target(s) Regulated by This miRNA Proto-oncogene c-Met (MET) Target Info
MET_HUMAN
Proto-oncogene c-Myc (MYC) Target Info
MYC_HUMAN
miRNA Mature ID hsa-let-7c-5p miRNA Info
miRNA Mature AC
MIMAT0000064
Sequence ugagguaguagguuguaugguu
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of let-7c-5p by Anti-miRNA Oligonucleotides resulted in the increased protein level of target MYC. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-let-7g-5p miRNA Info
miRNA Mature AC
MIMAT0000414
Sequence ugagguaguaguuuguacaguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [31]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [32]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-126-5p miRNA Info
miRNA Mature AC
MIMAT0000444
Sequence cauuauuacuuuugguacgcg
miRNA Species Homo sapiens
Regulation Mechanism c-Myc as a target of miR-126, and miR-126 is acted as an important mediator of MMSET regulation of c-MYC. [33]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [33]
Representative Target(s) Regulated by This miRNA Matrix metalloproteinase-7 (MMP-7) Target Info
MMP7_HUMAN
Proto-oncogene c-Crk (c-Crk) Target Info
CRK_HUMAN
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-130a significantly reduced cmyc. [34]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [34]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism Direct inhibition of Myc is by miR-148a-5p. [35]
Evidence Score (E-score) 1 +
1 Immunoblot [35]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-155 is extensively involved in the cancer pathogenesis of gastric carcinoma and support its function as recessive genes by targeting c-myc. [36]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [36]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism c-Myc abundance was repressed by miR-17 transduction in MCF-7 cells. [37]
Evidence Score (E-score) 1 +
1 Western Blot [37]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-184 miRNA Info
miRNA Mature AC
MIMAT0000454
Sequence uggacggagaacugauaagggu
miRNA Species Homo sapiens
Regulation Mechanism c-Myc were the direct target of miR-184 in NPC cells. [38]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [38]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Platelet-derived growth factor B (PDGFB) Target Info
PDGFB_HUMAN
miRNA Mature ID hsa-miR-185-5p miRNA Info
miRNA Mature AC
MIMAT0000455
Sequence uggagagaaaggcaguuccuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [39]
Representative Target(s) Regulated by This miRNA Androgen receptor (AR) Target Info
ANDR_HUMAN
Arachidonate 12-lipoxygenase (12-LOX) Target Info
LOX12_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [32]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-19b-1-5p miRNA Info
miRNA Mature AC
MIMAT0004491
Sequence aguuuugcagguuugcauccagc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [32]
Representative Target(s) Regulated by This miRNA Caspase-8 (CASP8) Target Info
CASP8_HUMAN
Fibroblast growth factor receptor 2 (FGFR2) Target Info
FGFR2_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism c-Myc abundance was repressed by miR-20 transduction in MCF-7 cells. [37]
Evidence Score (E-score) 1 +
1 Western Blot [37]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism E2 induced the expression of miR-21 reduced the levels of MYC protein. [26]
Evidence Score (E-score) 1 +
1 Northern Blot [26]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-212-3p miRNA Info
miRNA Mature AC
MIMAT0000269
Sequence uaacagucuccagucacggcc
miRNA Species Homo sapiens
Regulation Mechanism miR-212 might act on the progression of gastric cancer through the potential target gene Myc. [40]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [40]
Representative Target(s) Regulated by This miRNA Acetylcholinesterase (AChE) Target Info
ACES_HUMAN
Adenylate cyclase type 1 (ADCY1) Target Info
ADCY1_HUMAN
miRNA Mature ID hsa-miR-24-3p miRNA Info
miRNA Mature AC
MIMAT0000080
Sequence uggcucaguucagcaggaacag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-24-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target MYC. [2]
Evidence Score (E-score) 1 +
1 Western Blot; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-25-3p miRNA Info
miRNA Mature AC
MIMAT0000081
Sequence cauugcacuugucucggucuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 TRAP [25]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miRNA-29a is a tumor suppressor that plays an important role during PRIMA-1Met-induced apoptotic signaling by targeting c-Myc. [41]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [41]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-324-3p miRNA Info
miRNA Mature AC
MIMAT0000762
Sequence cccacugccccaggugcugcugg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [42]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
CREB-binding protein (CREBBP) Target Info
CBP_HUMAN
miRNA Mature ID hsa-miR-33a-5p miRNA Info
miRNA Mature AC
MIMAT0000091
Sequence gugcauuguaguugcauugca
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-33a significantly reduced luciferase activity of the pmirGLO construct with cloned 3'UTR sequences of MYC. [43]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [43]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
ATP-binding cassette transporter B11 (ABCB11) Target Info
ABCBB_HUMAN
miRNA Mature ID hsa-miR-34a-3p miRNA Info
miRNA Mature AC
MIMAT0004557
Sequence caaucagcaaguauacugcccu
miRNA Species Homo sapiens
Regulation Mechanism miR-34a inhibited invasiveness of JEG-3 cells by targeting MYC. [44]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [44]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-373-3p miRNA Info
miRNA Mature AC
MIMAT0000726
Sequence gaagugcuucgauuuuggggugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 In Situ Hybridization; Western Blot [45]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Cell surface protein HB15 (CD83) Target Info
CD83_HUMAN
miRNA Mature ID hsa-miR-429 miRNA Info
miRNA Mature AC
MIMAT0001536
Sequence uaauacugucugguaaaaccgu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Reporter Assay; Western Blot [46]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
miRNA Mature ID hsa-miR-487b-3p miRNA Info
miRNA Mature AC
MIMAT0003180
Sequence aaucguacagggucauccacuu
miRNA Species Homo sapiens
Regulation Mechanism miR-487b directly targeted MYC. [47]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [47]
Representative Target(s) Regulated by This miRNA Metabotropic glutamate receptor 3 (mGluR3) Target Info
GRM3_HUMAN
Polycomb complex protein BMI-1 (BMI1) Target Info
BMI1_HUMAN
miRNA Mature ID hsa-miR-494-3p miRNA Info
miRNA Mature AC
MIMAT0002816
Sequence ugaaacauacacgggaaaccuc
miRNA Species Homo sapiens
Regulation Mechanism miR-494 is downregulated in human GC and acts as an anti-oncogene by targeting c-myc. [48]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [48]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-92a-1-5p miRNA Info
miRNA Mature AC
MIMAT0004507
Sequence agguugggaucgguugcaaugcu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [32]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [42]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-25-5p miRNA Info
miRNA Mature AC
MIMAT0004498
Sequence aggcggagacuugggcaauug
miRNA Species Homo sapiens
Regulation Mechanism miR-25 has anti-apoptosis roles in AGS cells via inhibiting FBXW7 and thus promoting oncogenes, such as CCNE1 and MYC. [49]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [49]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-E1 (CCNE1) Target Info
CCNE1_HUMAN
Protein kinase C zeta (PRKCZ) Target Info
KPCZ_HUMAN
miRNA Mature ID hsa-miR-371a-3p miRNA Info
miRNA Mature AC
MIMAT0000723
Sequence aagugccgccaucuuuugagugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 In Situ Hybridization [45]
Representative Target(s) Regulated by This miRNA Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
Proto-oncogene c-Myc (MYC) Target Info
MYC_HUMAN
miRNA Mature ID hsa-miR-561-3p miRNA Info
miRNA Mature AC
MIMAT0003225
Sequence caaaguuuaagauccuugaagu
miRNA Species Homo sapiens
Regulation Mechanism miR-561 acts as a novel tumor suppressor in gastric cancer by targeting c-Myc gene and inhibiting gastric cancer cells proliferation and invasion. [50]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [50]
Representative Target(s) Regulated by This miRNA Orphan nuclear receptor DAX-1 (NR0B1) Target Info
NR0B1_HUMAN
Proto-oncogene c-Myc (MYC) Target Info
MYC_HUMAN
miRNA Mature ID hsa-miR-744-5p miRNA Info
miRNA Mature AC
MIMAT0004945
Sequence ugcggggcuagggcuaacagca
miRNA Species Homo sapiens
Regulation Mechanism Wild type targeting sequence of c-Myc mRNA caused a significant decrease in luciferase activity in cells transfected with miR-744. [51]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Immunohistochemistry; Western Blot [51]
Representative Target(s) Regulated by This miRNA Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
Proto-oncogene c-Myc (MYC) Target Info
MYC_HUMAN
miRNA Mature ID hsa-miR-92a-2-5p miRNA Info
miRNA Mature AC
MIMAT0004508
Sequence ggguggggauuuguugcauuac
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [32]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-19b-2-5p miRNA Info
miRNA Mature AC
MIMAT0004492
Sequence aguuuugcagguuugcauuuca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR [32]
Representative Target(s) Regulated by This miRNA Proto-oncogene c-Myc (MYC) Target Info
MYC_HUMAN
miRNA Mature ID hsa-miR-599 miRNA Info
miRNA Mature AC
MIMAT0003267
Sequence guugugucaguuuaucaaac
miRNA Species Homo sapiens
Regulation Mechanism MYC (v-myc avian myelocytomatosis viral onco-gene homolog) is a target gene of hsa-miR-599. [52]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [52]
Representative Target(s) Regulated by This miRNA Proto-oncogene c-Myc (MYC) Target Info
MYC_HUMAN
References  Top
REF 1 Identification of novel microRNA signatures linked to acquired aplastic anemia. Haematologica. 2015 Dec;100(12):1534-45.
REF 2 Prediction and preliminary validation of oncogene regulation by miRNAs. BMC Mol Biol. 2007 Sep 18;8:79.
REF 3 miRNA-145 inhibits non-small cell lung cancer cell proliferation by targeting c-Myc. J Exp Clin Cancer Res. 2010 Nov 22;29:151.
REF 4 Screening key microRNAs for castration-resistant prostate cancer based on miRNA/mRNA functional synergistic network. Oncotarget. 2015 Dec 22;6(41):43819-30.
REF 5 p53 represses c-Myc through induction of the tumor suppressor miR-145. Proc Natl Acad Sci U S A. 2009 Mar 3;106(9):3207-12.
REF 6 MiR-145 inhibits oral squamous cell carcinoma (OSCC) cell growth by targeting c-Myc and Cdk6. Cancer Cell Int. 2013 May 28;13(1):51.
REF 7 MicroRNA-34a suppresses malignant transformation by targeting c-Myc transcriptional complexes in human renal cell carcinoma. Carcinogenesis. 2012 Feb;33(2):294-300.
REF 8 MicroRNA-200c attenuates tumour growth and metastasis of presumptive head and neck squamous cell carcinoma stem cells. J Pathol. 2011 Mar;223(4):482-95.
REF 9 p53-independent upregulation of miR-34a during oncogene-induced senescence represses MYC. Cell Death Differ. 2010 Feb;17(2):236-45.
REF 10 Anti-proliferative effects of polyphenols from pomegranate rind (Punica granatum L.) on EJ bladder cancer cells via regulation of p53/miR-34a axis. Phytother Res. 2015 Mar;29(3):415-22.
REF 11 Myc overexpression brings out unexpected antiapoptotic effects of miR-34a. Oncogene. 2011 Jun 2;30(22):2587-94.
REF 12 MYC translocation-negative classical Burkitt lymphoma cases: an alternative pathogenetic mechanism involving miRNA deregulation. J Pathol. 2008 Dec;216(4):440-50.
REF 13 MYC is activated by USP2a-mediated modulation of microRNAs in prostate cancer. Cancer Discov. 2012 Mar;2(3):236-47.
REF 14 A microRNA DNA methylation signature for human cancer metastasis. Proc Natl Acad Sci U S A. 2008 Sep 9;105(36):13556-61.
REF 15 The miR-34 family in cancer and apoptosis. Cell Death Differ. 2010 Feb;17(2):193-9.
REF 16 MicroRNA-451 induces epithelial-mesenchymal transition in docetaxel-resistant lung adenocarcinoma cells by targeting proto-oncogene c-Myc. Eur J Cancer. 2014 Nov;50(17):3050-67.
REF 17 Repression of tumor suppressor miR-451 is essential for NOTCH1-induced oncogenesis in T-ALL. J Exp Med. 2011 Apr 11;208(4):663-75.
REF 18 miR-451 suppresses bladder cancer cell migration and invasion via directly targeting c-Myc. Oncol Rep. 2016 Oct;36(4):2049-58.
REF 19 Endogenous human microRNAs that suppress breast cancer metastasis. Nature. 2008 Jan 10;451(7175):147-52.
REF 20 MicroRNA miR-335 is crucial for the BRCA1 regulatory cascade in breast cancer development. Int J Cancer. 2011 Dec 15;129(12):2797-806.
REF 21 A statin-regulated microRNA represses human c-Myc expression and function. EMBO Mol Med. 2012 Sep;4(9):896-909.
REF 22 DNA Methylation mediated down-regulating of MicroRNA-33b and its role in gastric cancer. Sci Rep. 2016 Jan 5;6:18824.
REF 23 Myc/miR-378/TOB2/cyclin D1 functional module regulates oncogenic transformation. Oncogene. 2011 May 12;30(19):2242-51.
REF 24 MicroRNA-449a enhances radiosensitivity by downregulation of c-Myc in prostate cancer cells. Sci Rep. 2016 Jun 2;6:27346.
REF 25 Rapid identification of regulatory microRNAs by miTRAP (miRNA trapping by RNA in vitro affinity purification). Nucleic Acids Res. 2014 Apr;42(8):e66.
REF 26 Estradiol-regulated microRNAs control estradiol response in breast cancer cells. Nucleic Acids Res. 2009 Aug;37(14):4850-61.
REF 27 MicroRNA target prediction by expression analysis of host genes. Genome Res. 2009 Mar;19(3):481-90.
REF 28 Neurotensin signaling stimulates glioblastoma cell proliferation by upregulating c-Myc and inhibiting miR-29b-1 and miR-129-3p. Neuro Oncol. 2016 Feb;18(2):216-26.
REF 29 MiR-449c targets c-Myc and inhibits NSCLC cell progression. FEBS Lett. 2013 May 2;587(9):1359-65.
REF 30 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 31 Hsa-let-7g inhibits proliferation of hepatocellular carcinoma cells by downregulation of c-Myc and upregulation of p16(INK4A). Int J Cancer. 2011 Jan 15;128(2):319-31.
REF 32 Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63.
REF 33 MMSET stimulates myeloma cell growth through microRNA-mediated modulation of c-MYC. Leukemia. 2013 Mar;27(3):686-94.
REF 34 MicroRNA-130a associates with ribosomal protein L11 to suppress c-Myc expression in response to UV irradiation. Oncotarget. 2015 Jan 20;6(2):1101-14.
REF 35 A c-Myc-MicroRNA functional feedback loop affects hepatocarcinogenesis. Hepatology. 2013 Jun;57(6):2378-89.
REF 36 Downregulation of microRNA-155 accelerates cell growth and invasion by targeting c-myc in human gastric carcinoma cells. Oncol Rep. 2014 Sep;32(3):951-6.
REF 37 A cyclin D1/microRNA 17/20 regulatory feedback loop in control of breast cancer cell proliferation. J Cell Biol. 2008 Aug 11;182(3):509-17.
REF 38 Tumor suppressor PDCD4 modulates miR-184-mediated direct suppression of C-MYC and BCL2 blocking cell growth and survival in nasopharyngeal carcinoma. Cell Death Dis. 2013 Oct 24;4:e872.
REF 39 Gastrokine 1 inhibits gastric cancer cell migration and invasion by downregulating RhoA expression. Gastric Cancer. 2017 Mar;20(2):274-285.
REF 40 Down-regulation of miR-212 expression by DNA hypermethylation in human gastric cancer cells. Med Oncol. 2011 Dec;28 Suppl 1:S189-96.
REF 41 MiRNA-29a as a tumor suppressor mediates PRIMA-1Met-induced anti-myeloma activity by targeting c-Myc. Oncotarget. 2016 Feb 9;7(6):7149-60.
REF 42 Genome-wide analyses of radioresistance-associated miRNA expression profile in nasopharyngeal carcinoma using next generation deep sequencing. PLoS One. 2013 Dec 19;8(12):e84486.
REF 43 XB130, a new adaptor protein, regulates expression of tumor suppressive microRNAs in cancer cells. PLoS One. 2013;8(3):e59057.
REF 44 MicroRNA-34a inhibits human trophoblast cell invasion by targeting MYC. BMC Cell Biol. 2015 Sep 3;16:21.
REF 45 Stem cell-like micro-RNA signature driven by Myc in aggressive liver cancer. Proc Natl Acad Sci U S A. 2010 Nov 23;107(47):20471-6.
REF 46 miR-429 modulates the expression of c-myc in human gastric carcinoma cells. Eur J Cancer. 2011 Nov;47(17):2552-9.
REF 47 Cigarette smoke mediates epigenetic repression of miR-487b during pulmonary carcinogenesis. J Clin Invest. 2013 Mar;123(3):1241-61.
REF 48 miR-494 acts as an anti-oncogene in gastric carcinoma by targeting c-myc. J Gastroenterol Hepatol. 2014;29(7):1427-34.
REF 49 microRNA-25 Inhibits Cell Apoptosis of Human Gastric Adenocarcinoma Cell Line AGS via Regulating CCNE1 and MYC. Med Sci Monit. 2016 Apr 27;22:1415-20.
REF 50 MicroRNA-561 inhibits gastric cancercell proliferation and invasion by downregulating c-Myc expression. Am J Transl Res. 2016 Sep 15;8(9):3802-3811.
REF 51 Decrease expression of microRNA-744 promotes cell proliferation by targeting c-Myc in human hepatocellular carcinoma. Cancer Cell Int. 2014 Jun 22;14:58.
REF 52 Identification a novel tumor-suppressive hsa-miR-599 regulates cells proliferation, migration and invasion by targeting oncogenic MYC in hepatocell... Am J Transl Res. 2016 Jun 15;8(6):2575-84.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.