miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-599 | ||||
| miRNA Stemloop AC | MI0003611 | ||||
| miRNA Stemloop ID | hsa-mir-599 | ||||
| Sequence | guugugucaguuuaucaaac | ||||
| TTD Target(s) Regulated by This miRNA | Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | DNA-binding protein SATB2 | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Identification a novel tumor-suppressive hsa-miR-599 regulates cells proliferation, migration and invasion by targeting oncogenic MYC in hepatocell... Am J Transl Res. 2016 Jun 15;8(6):2575-84. | ||||
| REF 2 | The miR-599 promotes non-small cell lung cancer cell invasion via SATB2.Biochem Biophys Res Commun. 2017 Mar 25;485(1):35-40. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.