miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-let-7c-5p | ||||
| miRNA Stemloop AC | MI0000064 | ||||
| miRNA Stemloop ID | hsa-let-7c | ||||
| Sequence | ugagguaguagguuguaugguu | ||||
| TTD Target(s) Regulated by This miRNA | Serine/threonine-protein kinase mTOR (mTOR) | Successful Target | Target Info | [1] | |
| Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [2] | ||
| Interleukin-6 (IL6) | Successful Target | Target Info | [3] | ||
| Signal transducer and activator of transcription 3 (STAT3) | Successful Target | Target Info | [4] | ||
| Thrombopoietin receptor (MPL) | Successful Target | Target Info | [5] | ||
| TGF-beta receptor type I (TGFBR1) | Clinical trial Target | Target Info | [6] | ||
| Apoptosis regulator Bcl-xL (BCL-xL) | Clinical trial Target | Target Info | [7] | ||
| Caspase-3 (CASP3) | Clinical trial Target | Target Info | [8] | ||
| TRAIL receptor 2 (TRAIL-R2) | Clinical trial Target | Target Info | [9] | ||
| GTPase NRas (NRAS) | Clinical trial Target | Target Info | [10] | ||
| Interleukin-10 (IL10) | Clinical trial Target | Target Info | [11] | ||
| M-phase inducer phosphatase 1 (MPIP1) | Literature-reported Target | Target Info | [12] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [13] | ||
| MEK kinase kinase 3 (MAP4K3) | Literature-reported Target | Target Info | [14] | ||
| CCAAT/enhancer binding protein beta (CEBPB) | Literature-reported Target | Target Info | [15] | ||
| Integrin beta-3 (ITGB3) | Literature-reported Target | Target Info | [14] | ||
| MTOR complex 2 (RICTOR) | Literature-reported Target | Target Info | [1] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [16] | ||
| Protein(s) Regulated by This miRNA | COP9 signalosome complex subunit 1 | Regulated Protein | [17] | ||
| COP9 signalosome complex subunit 6 | Regulated Protein | [17] | |||
| COP9 signalosome complex subunit 8 | Regulated Protein | [17] | |||
| E3 ubiquitin-protein ligase TRIM71 | Regulated Protein | [18] | |||
| Heat shock 70 kDa protein 4 | Regulated Protein | [19] | |||
| Pre-B-cell leukemia transcription factor 2 | Regulated Protein | [20] | |||
| Protein argonaute-1 | Regulated Protein | [21] | |||
| Protein numb homolog | Regulated Protein | [22] | |||
| Tribbles homolog 2 | Regulated Protein | [23] | |||
| References | |||||
| REF 1 | microRNA-mediated regulation of mTOR complex components facilitates discrimination between activation and anergy in CD4 T cells. J Exp Med. 2014 Oct 20;211(11):2281-95. | ||||
| REF 2 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
| REF 3 | Loss of let-7 microRNA upregulates IL-6 in bone marrow-derived mesenchymal stem cells triggering a reactive stromal response to prostate cancer. PLoS One. 2013 Aug 19;8(8):e71637. | ||||
| REF 4 | Anti-inflammatory role of microRNA let-7c in LPS treated alveolar macrophages by targeting STAT3. Asian Pac J Trop Med. 2016 Jan;9(1):72-5. | ||||
| REF 5 | miR-28 is a thrombopoietin receptor targeting microRNA detected in a fraction of myeloproliferative neoplasm patient platelets. Blood. 2010 Jul 22;116(3):437-45. | ||||
| REF 6 | Comprehensive gene and microRNA expression profiling reveals a role for microRNAs in human liver development. PLoS One. 2009 Oct 20;4(10):e7511. | ||||
| REF 7 | The let-7 family of microRNAs inhibits Bcl-xL expression and potentiates sorafenib-induced apoptosis in human hepatocellular carcinoma. J Hepatol. 2010 May;52(5):698-704. | ||||
| REF 8 | MicroRNA let-7c-5p protects against cerebral ischemia injury via mechanisms involving the inhibition of microglia activation. Brain Behav Immun. 2015 Oct;49:75-85. | ||||
| REF 9 | Nuclear death receptor TRAIL-R2 inhibits maturation of let-7 and promotes proliferation of pancreatic and other tumor cells. Gastroenterology. 2014 Jan;146(1):278-90. | ||||
| REF 10 | RAS is regulated by the let-7 microRNA family. Cell. 2005 Mar 11;120(5):635-47. | ||||
| REF 11 | Altered let-7 expression in Myasthenia gravis and let-7c mediated regulation of IL-10 by directly targeting IL-10 in Jurkat cells. Int Immunopharmacol. 2012 Oct;14(2):217-23. | ||||
| REF 12 | The let-7 microRNA represses cell proliferation pathways in human cells. Cancer Res. 2007 Aug 15;67(16):7713-22. | ||||
| REF 13 | Prediction and preliminary validation of oncogene regulation by miRNAs. BMC Mol Biol. 2007 Sep 18;8:79. | ||||
| REF 14 | MicroRNA let-7c inhibits migration and invasion of human non-small cell lung cancer by targeting ITGB3 and MAP4K3. Cancer Lett. 2014 Jan 1;342(1):43-51. | ||||
| REF 15 | MicroRNA let-7c regulates macrophage polarization. J Immunol. 2013 Jun 15;190(12):6542-9. | ||||
| REF 16 | High mobility group A2 is a target for miRNA-98 in head and neck squamous cell carcinoma. Mol Cancer. 2007 Jan 14;6:5. | ||||
| REF 17 | Post-transcriptional fine-tuning of COP9 signalosome subunit biosynthesis is regulated by the c-Myc/Lin28B/let-7 pathway.J Mol Biol. 2011 Jun 24;409(5):710-21. | ||||
| REF 18 | Human TRIM71 and its nematode homologue are targets of let-7 microRNA and its zebrafish orthologue is essential for development.Mol Biol Evol. 2007 Nov;24(11):2525-34. | ||||
| REF 19 | Let-7c miRNA Inhibits the Proliferation and Migration of Heat-Denatured Dermal Fibroblasts Through Down-Regulating HSP70.Mol Cells. 2016 Apr 30;39(4):345-51. | ||||
| REF 20 | miRNA let-7c promotes granulocytic differentiation in acute myeloid leukemia.Oncogene. 2013 Aug 1;32(31):3648-54. | ||||
| REF 21 | Hypoxia-responsive miRNAs target argonaute 1 to promote angiogenesis.J Clin Invest. 2013 Mar;123(3):1057-67. | ||||
| REF 22 | Up-regulation of microRNA let-7c by quercetin inhibits pancreatic cancer progression by activation of Numbl.Oncotarget. 2016 Sep 6;7(36):58367-58380. | ||||
| REF 23 | Let-7c inhibits A549 cell proliferation through oncogenic TRIB2 related factors.FEBS Lett. 2013 Aug 19;587(16):2675-81. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.