miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-185-5p | ||||
| miRNA Stemloop AC | MI0000482 | ||||
| miRNA Stemloop ID | hsa-mir-185 | ||||
| Sequence | uggagagaaaggcaguuccuga | ||||
| TTD Target(s) Regulated by This miRNA | Androgen receptor (AR) | Successful Target | Target Info | [1] | |
| Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [2] | ||
| Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [3] | ||
| NT-3 growth factor receptor (TrkC) | Successful Target | Target Info | [4] | ||
| Transforming growth factor beta 1 (TGFB1) | Successful Target | Target Info | [5] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [6] | ||
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [7] | ||
| DNA [cytosine-5]-methyltransferase 1 (DNMT1) | Clinical trial Target | Target Info | [8] | ||
| Enhancer of zeste homolog 2 (EZH2) | Successful Target | Target Info | [9] | ||
| Ephrin type-B receptor 2 (EPHB2) | Clinical trial Target | Target Info | [10] | ||
| Sodium/hydrogen exchanger 1 (SLC9A1) | Clinical trial Target | Target Info | [11] | ||
| Serine/threonine-protein kinase ATR (FRP1) | Clinical trial Target | Target Info | [12] | ||
| Hypoxia-inducible factor 2 alpha (HIF-2A) | Successful Target | Target Info | [13] | ||
| Transforming protein RhoA (RHOA) | Discontinued Target | Target Info | [14] | ||
| Arachidonate 12-lipoxygenase (12-LOX) | Literature-reported Target | Target Info | [15] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [16] | ||
| G1/S-specific cyclin-E1 (CCNE1) | Literature-reported Target | Target Info | [17] | ||
| High mobility group protein HMG-I/Y (HMGA1) | Literature-reported Target | Target Info | [3] | ||
| Scavenger receptor class B member 1 (SCARB1) | Literature-reported Target | Target Info | [18] | ||
| Sodium calcium exchanger 1 (SLC8A1) | Literature-reported Target | Target Info | [19] | ||
| Sterol regulatory element binding protein-1 (SREBF1) | Literature-reported Target | Target Info | [20] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [21] | ||
| Protein(s) Regulated by This miRNA | Activity-regulated cytoskeleton-associated protein | Regulated Protein | [22] | ||
| Aquaporin-3 | Regulated Protein | [15] | |||
| ATP-binding cassette sub-family G member 4 | Regulated Protein | [24] | |||
| Calcium/calmodulin-dependent protein kinase type II subunit delta | Regulated Protein | [19] | |||
| Calcium/calmodulin-dependent protein kinase type IV | Regulated Protein | [3] | |||
| Caspase-14 | Regulated Protein | [15] | |||
| Cell division control protein 42 homolog | Regulated Protein | [14] | |||
| Collagen alpha-1(I) chain | Regulated Protein | [5] | |||
| Coronin-2B | Regulated Protein | [7] | |||
| Dual specificity protein phosphatase 4 | Regulated Protein | [3] | |||
| Homeobox protein SIX1 | Regulated Protein | [30] | |||
| Interleukin-10 receptor subunit alpha | Regulated Protein | [31] | |||
| Marginal zone B- and B1-cell-specific protein | Regulated Protein | [3] | |||
| Nuclear factor of activated T-cells, cytoplasmic 3 | Regulated Protein | [3] | |||
| Placenta-specific gene 8 protein | Regulated Protein | [32] | |||
| Protein MCM10 homolog | Regulated Protein | [3] | |||
| Sterol regulatory element-binding protein 2 | Regulated Protein | [20] | |||
| Stromal interaction molecule 1 | Regulated Protein | [34] | |||
| Thyroglobulin | Regulated Protein | [5] | |||
| Tripartite motif-containing protein 29 | Regulated Protein | [35] | |||
| References | |||||
| REF 1 | MicroRNA-185 suppresses proliferation, invasion, migration, and tumorigenicity of human prostate cancer cells through targeting androgen receptor. Mol Cell Biochem. 2013 May;377(1-2):121-30. | ||||
| REF 2 | Physiological identification of human transcripts translationally regulated by a specific microRNA. Hum Mol Genet. 2005 Dec 15;14(24):3813-21. | ||||
| REF 3 | Transgenic expression of microRNA-185 causes a developmental arrest of T cells by targeting multiple genes including Mzb1. J Biol Chem. 2013 Oct 18;288(42):30752-62. | ||||
| REF 4 | Overexpression of miR-128 specifically inhibits the truncated isoform of NTRK3 and upregulates BCL2 in SH-SY5Y neuroblastoma cells. BMC Mol Biol. 2010 Dec 10;11:95. | ||||
| REF 5 | MicroRNA 85 regulates transforming growth factor and collagen in hypertrophic scar fibroblasts. Mol Med Rep. 2017 Apr;15(4):1489-1496. | ||||
| REF 6 | MiR-185 is involved in human breast carcinogenesis by targeting Vegfa. FEBS Lett. 2014 Nov 28;588(23):4438-47. | ||||
| REF 7 | MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines. PLoS One. 2009 Aug 18;4(8):e6677. | ||||
| REF 8 | MiR-185 targets the DNA methyltransferases 1 and regulates global DNA methylation in human glioma. Mol Cancer. 2011 Sep 30;10:124. | ||||
| REF 9 | GKN1-miR-185-DNMT1 axis suppresses gastric carcinogenesis through regulation of epigenetic alteration and cell cycle. Clin Cancer Res. 2013 Sep 1;19(17):4599-610. | ||||
| REF 10 | Regulation of microcystin-LR-induced toxicity in mouse spermatogonia by miR-96. Environ Sci Technol. 2014 Jun 3;48(11):6383-90. | ||||
| REF 11 | miR-185 inhibits endoplasmic reticulum stress-induced apoptosis by targeting Na+/H+ exchanger-1 in the heart. BMB Rep. 2016 Apr;49(4):208-13. News | ||||
| REF 12 | Repression of ATR pathway by miR-185 enhances radiation-induced apoptosis and proliferation inhibition. Cell Death Dis. 2013 Jun 27;4:e699. | ||||
| REF 13 | Functional importance of Dicer protein in the adaptive cellular response to hypoxia. J Biol Chem. 2012 Aug 17;287(34):29003-20. | ||||
| REF 14 | miR-185 targets RhoA and Cdc42 expression and inhibits the proliferation potential of human colorectal cells. Cancer Lett. 2011 Feb 28;301(2):151-60. | ||||
| REF 15 | Phospho-Np63 regulates AQP3, ALOX12B, CASP14 and CLDN1 expression through transcription and microRNA modulation. FEBS Lett. 2013 Nov 1;587(21):3581-6. | ||||
| REF 16 | Gastrokine 1 inhibits gastric cancer cell migration and invasion by downregulating RhoA expression. Gastric Cancer. 2017 Mar;20(2):274-285. | ||||
| REF 17 | miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 2008 Sep;36(16):5391-404. | ||||
| REF 18 | MicroRNAs 185, 96, and 223 repress selective high-density lipoprotein cholesterol uptake through posttranscriptional inhibition. Mol Cell Biol. 2013 May;33(10):1956-64. | ||||
| REF 19 | miR-185 plays an anti-hypertrophic role in the heart via multiple targets in the calcium-signaling pathways. PLoS One. 2015 Mar 13;10(3):e0122509. | ||||
| REF 20 | MicroRNA-185 and 342 inhibit tumorigenicity and induce apoptosis through blockade of the SREBP metabolic pathway in prostate cancer cells. PLoS One. 2013 Aug 9;8(8):e70987. | ||||
| REF 21 | High mobility group A2 is a target for miRNA-98 in head and neck squamous cell carcinoma. Mol Cancer. 2007 Jan 14;6:5. | ||||
| REF 22 | MicroRNA-185 regulates chemotherapeutic sensitivity in gastric cancer by targeting apoptosis repressor with caspase recruitment domain.Cell Death Dis. 2014 Apr 24;5:e1197. | ||||
| REF 23 | Phospho-Np63 regulates AQP3, ALOX12B, CASP14 and CLDN1 expression through transcription and microRNA modulation. FEBS Lett. 2013 Nov 1;587(21):3581-6. | ||||
| REF 24 | Modulation of miR-185-5p expression by EBV-miR-BART6 contributes to developmental differences in ABCG4 gene expression in human megakaryocytes.Int J Biochem Cell Biol. 2016 Dec;81(Pt A):105-111. | ||||
| REF 25 | miR-185 plays an anti-hypertrophic role in the heart via multiple targets in the calcium-signaling pathways. PLoS One. 2015 Mar 13;10(3):e0122509. | ||||
| REF 26 | Transgenic expression of microRNA-185 causes a developmental arrest of T cells by targeting multiple genes including Mzb1. J Biol Chem. 2013 Oct 18;288(42):30752-62. | ||||
| REF 27 | miR-185 targets RhoA and Cdc42 expression and inhibits the proliferation potential of human colorectal cells. Cancer Lett. 2011 Feb 28;301(2):151-60. | ||||
| REF 28 | MicroRNA 85 regulates transforming growth factor and collagen in hypertrophic scar fibroblasts. Mol Med Rep. 2017 Apr;15(4):1489-1496. | ||||
| REF 29 | MiR-107 and MiR-185 can induce cell cycle arrest in human non small cell lung cancer cell lines. PLoS One. 2009 Aug 18;4(8):e6677. | ||||
| REF 30 | MicroRNA-185 suppresses tumor growth and progression by targeting the Six1 oncogene in human cancers.Oncogene. 2010 Sep 2;29(35):4971-9. | ||||
| REF 31 | IL-10R expression is post-transcriptionally regulated by miR-15a, miR-185, and miR-211 in melanoma.BMC Med Genomics. 2015 Dec 3;8:81. | ||||
| REF 32 | Down-regulated PLAC8 promotes hepatocellular carcinoma cell proliferation by enhancing PI3K/Akt/GSK3/Wnt/-catenin signaling.Biomed Pharmacother. 2016 Dec;84:139-146. | ||||
| REF 33 | MicroRNA-185 and 342 inhibit tumorigenicity and induce apoptosis through blockade of the SREBP metabolic pathway in prostate cancer cells. PLoS One. 2013 Aug 9;8(8):e70987. | ||||
| REF 34 | STIM1, a direct target of microRNA-185, promotes tumor metastasis and is associated with poor prognosis in colorectal cancer.Oncogene. 2015 Sep 10;34(37):4808-20. | ||||
| REF 35 | TRIM29 functions as an oncogene in gastric cancer and is regulated by miR-185. Int J Clin Exp Pathol. 2015 May 1;8(5):5053-61. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.