miRNA General Information
miRNA Mature ID	hsa-miR-145-5p
miRNA Stemloop AC	MI0000461
miRNA Stemloop ID	hsa-mir-145
Sequence	guccaguuuucccaggaaucccu
TTD Target(s) Regulated by This miRNA	Epidermal growth factor receptor (EGFR)	Successful Target	Target Info	[1]
	Estrogen receptor (ESR)	Successful Target	Target Info	[2]
	Matrix metalloproteinase-1 (MMP-1)	Successful Target	Target Info	[3]
	Serine/threonine-protein kinase B-raf (BRAF)	Successful Target	Target Info	[4]
	Aromatic-L-amino-acid decarboxylase (DDC)	Successful Target	Target Info	[5]
	Calcineurin (PPP3CA)	Successful Target	Target Info	[6]
	Cyclin-dependent kinase 4 (CDK4)	Successful Target	Target Info	[7]
	Cyclin-dependent kinase 6 (CDK6)	Successful Target	Target Info	[8]
	Insulin-like growth factor I receptor (IGF1R)	Successful Target	Target Info	[9]
	Multidrug resistance-associated protein 1 (ABCC1)	Successful Target	Target Info	[10]
	cAMP-dependent chloride channel (CFTR)	Successful Target	Target Info	[11]
	Interferon-beta (IFNB1)	Successful Target	Target Info	[12]
	Vascular endothelial growth factor A (VEGFA)	Successful Target	Target Info	[13]
	T-cell-specific surface glycoprotein CD28 (CD28)	Successful Target	Target Info	[14]
	Rho-associated protein kinase 1 (ROCK1)	Successful Target	Target Info	[15]
	Histone deacetylase 2 (HDAC2)	Clinical trial Target	Target Info	[16]
	TNF alpha converting enzyme (ADAM17)	Clinical trial Target	Target Info	[17]
	Matrix metalloproteinase-12 (MMP-12)	Clinical trial Target	Target Info	[3]
	Matrix metalloproteinase-14 (MMP-14)	Clinical trial Target	Target Info	[3]
	Ribosomal protein S6 kinase beta-1 (S6K1)	Clinical trial Target	Target Info	[18]
	Ubiquitin-protein ligase E3 Mdm2 (MDM2)	Clinical trial Target	Target Info	[19]
	Yes tyrosine kinase (YES)	Clinical trial Target	Target Info	[20]
	Angiopoietin-2 (ANGPT2)	Successful Target	Target Info	[21]
	CD40L receptor (CD40)	Clinical trial Target	Target Info	[22]
	Endothelial plasminogen activator inhibitor (SERPINE1)	Clinical trial Target	Target Info	[23]
	Transforming growth factor beta 2 (TGFB2)	Clinical trial Target	Target Info	[24]
	GTPase NRas (NRAS)	Clinical trial Target	Target Info	[13]
	PAK-4 protein kinase (PAK4)	Clinical trial Target	Target Info	[25]
	TGF-beta receptor type II (TGFBR2)	Clinical trial Target	Target Info	[26]
	A proliferation-inducing ligand (APRIL)	Clinical trial Target	Target Info	[27]
	Connective tissue growth factor (CTGF)	Clinical trial Target	Target Info	[28]
	Frizzled-7 receptor (FZD7)	Clinical trial Target	Target Info	[29]
	Hypoxia-inducible factor 1 alpha (HIF-1A)	Clinical trial Target	Target Info	[30]
	Mucin-1 (MUC1)	Clinical trial Target	Target Info	[31]
	Neural cadherin (CDH2)	Clinical trial Target	Target Info	[32]
	Extracellular matrix receptor III (CD44)	Clinical trial Target	Target Info	[4]
	Hypoxia-inducible factor 2 alpha (HIF-2A)	Successful Target	Target Info	[33]
	Spectrin non-erythroid beta chain 1 (SPTBN1)	Clinical trial Target	Target Info	[34]
	Fascin (FSCN1)	Clinical trial Target	Target Info	[35]
	Kruppel like factor 4 (KLF4)	Clinical trial Target	Target Info	[36]
	Transcription factor Sp1 (SP1)	Clinical trial Target	Target Info	[8]
	Signal transducer and activator of transcription 1 (STAT1)	Patented-recorded Target	Target Info	[20]
	Histone deacetylase 11 (HDAC11)	Patented-recorded Target	Target Info	[37]
	Toll/interleukin-1 receptor domain-containing adapter (TIRAP)	Patented-recorded Target	Target Info	[38]
	Integrin-linked protein kinase 1 (ILK)	Patented-recorded Target	Target Info	[39]
	Proto-oncogene c-Myc (MYC)	Literature-reported Target	Target Info	[40]
	Protein tyrosine phosphatase IVA 2 (PRL-2)	Literature-reported Target	Target Info	[3]
	Sentrin specific protease-1 (SENP1)	Literature-reported Target	Target Info	[41]
	Alkaline phosphatase (ALPPL2)	Literature-reported Target	Target Info	[3]
	Integrin beta-8 (ITGB8)	Clinical trial Target	Target Info	[42]
	Junctional adhesion molecule A (F11R)	Literature-reported Target	Target Info	[43]
	Protein C-ets-1 (ETS1)	Literature-reported Target	Target Info	[44]
	Protein phosphatase 1D (PPM1D)	Literature-reported Target	Target Info	[45]
	DNA fragmentation factor alpha (DFFA)	Literature-reported Target	Target Info	[46]
	Enhancer of filamentation 1 (NEDD9)	Literature-reported Target	Target Info	[47]
	Eukaryotic initiation factor 4E (EIF4E)	Literature-reported Target	Target Info	[7]
	Insulin receptor substrate-1 (IRS1)	Clinical trial Target	Target Info	[48]
	Melanoma differentiation-associated protein 6 (CDKN1A)	Literature-reported Target	Target Info	[49]
	Metastasis adhesion protein (MTDH)	Literature-reported Target	Target Info	[50]
	Transcription factor SOX-2 (SOX2)	Literature-reported Target	Target Info	[23]
	High mobility group protein HMGI-C (HMGA2)	Literature-reported Target	Target Info	[51]
	Mothers against decapentaplegic homolog 3 (SMAD3)	Preclinical Target	Target Info	[52]
Protein(s) Regulated by This miRNA	7,8-dihydro-8-oxoguanine triphosphatase	Regulated Protein	8ODP_HUMAN	[1]
	Actin, cytoplasmic 1	Regulated Protein	ACTB_HUMAN	[54]
	Acyl-protein thioesterase 2	Regulated Protein	LYPA2_HUMAN	[3]
	ADP-ribosylation factor 6	Regulated Protein	ARF6_HUMAN	[56]
	Aldehyde dehydrogenase, dimeric NADP-preferring	Regulated Protein	AL3A1_HUMAN	[3]
	Aldo-keto reductase family 1 member B10	Regulated Protein	AK1BA_HUMAN	[3]
	Alpha/beta hydrolase domain-containing protein 17C	Regulated Protein	AB17C_HUMAN	[3]
	AP-1 complex subunit gamma-1	Regulated Protein	AP1G1_HUMAN	[3]
	Baculoviral IAP repeat-containing protein 1	Regulated Protein	BIRC1_HUMAN	[57]
	BCL2/adenovirus E1B 19 kDa protein-interacting protein 3	Regulated Protein	BNIP3_HUMAN	[58]
	Beta/gamma crystallin domain-containing protein 1	Regulated Protein	CRBG1_HUMAN	[59]
	Calcium/calmodulin-dependent protein kinase type 1D	Regulated Protein	KCC1D_HUMAN	[60]
	Catenin delta-1	Regulated Protein	CTND1_HUMAN	[61]
	Centrosomal protein of 19 kDa	Regulated Protein	CEP19_HUMAN	[3]
	Clathrin interactor 1	Regulated Protein	EPN4_HUMAN	[6]
	Coiled-coil domain-containing protein 43	Regulated Protein	CCD43_HUMAN	[3]
	Collagen alpha-1(V) chain	Regulated Protein	CO5A1_HUMAN	[63]
	Core-binding factor subunit beta	Regulated Protein	PEBB_HUMAN	[6]
	Costars family protein ABRACL	Regulated Protein	ABRAL_HUMAN	[3]
	Cytochrome c oxidase subunit NDUFA4	Regulated Protein	NDUA4_HUMAN	[3]
	Cytoplasmic polyadenylation element-binding protein 4	Regulated Protein	CPEB4_HUMAN	[29]
	D-aminoacyl-tRNA deacylase 1	Regulated Protein	DTD1_HUMAN	[3]
	DNA mismatch repair protein Msh3	Regulated Protein	MSH3_HUMAN	[65]
	DNA replication licensing factor MCM2	Regulated Protein	MCM2_HUMAN	[34]
	Dual specificity mitogen-activated protein kinase kinase 6	Regulated Protein	MP2K6_HUMAN	[3]
	Frataxin, mitochondrial	Regulated Protein	FRDA_HUMAN	[67]
	Friend leukemia integration 1 transcription factor	Regulated Protein	FLI1_HUMAN	[68]
	Gamma-adducin	Regulated Protein	ADDG_HUMAN	[69]
	Glia maturation factor beta	Regulated Protein	GMFB_HUMAN	[3]
	Golgi membrane protein 1	Regulated Protein	GOLM1_HUMAN	[3]
	Helicase-like transcription factor	Regulated Protein	HLTF_HUMAN	[3]
	Homeobox protein Hox-A9	Regulated Protein	HXA9_HUMAN	[70]
	Homeobox protein MIXL1	Regulated Protein	MIXL1_HUMAN	[3]
	Homeobox protein NANOG	Regulated Protein	NANOG_HUMAN	[71]
	Insulin receptor substrate 2	Regulated Protein	IRS2_HUMAN	[72]
	Keratin, type II cytoskeletal 7	Regulated Protein	K2C7_HUMAN	[73]
	Kinesin-like protein KIF21A	Regulated Protein	KI21A_HUMAN	[59]
	Kremen protein 1	Regulated Protein	KREM1_HUMAN	[3]
	Krueppel-like factor 5	Regulated Protein	KLF5_HUMAN	[4]
	Mesoderm-specific transcript homolog protein	Regulated Protein	MEST_HUMAN	[3]
	Mothers against decapentaplegic homolog 2	Regulated Protein	SMAD2_HUMAN	[24]
	Myelin regulatory factor	Regulated Protein	MYRF_HUMAN	[29]
	Myocardin	Regulated Protein	MYCD_HUMAN	[76]
	Myotubularin-related protein 14	Regulated Protein	MTMRE_HUMAN	[3]
	Nuclear factor of activated T-cells, cytoplasmic 1	Regulated Protein	NFAC1_HUMAN	[14]
	Paxillin	Regulated Protein	PAXI_HUMAN	[78]
	Phosphatase and actin regulator 2	Regulated Protein	PHAR2_HUMAN	[59]
	Phosphatidylinositol-glycan biosynthesis class F protein	Regulated Protein	PIGF_HUMAN	[3]
	Podocalyxin	Regulated Protein	PODXL_HUMAN	[3]
	POU domain, class 5, transcription factor 1	Regulated Protein	PO5F1_HUMAN	[36]
	PRA1 family protein 3	Regulated Protein	PRAF3_HUMAN	[3]
	Probable ATP-dependent RNA helicase DDX17	Regulated Protein	DDX17_HUMAN	[80]
	Probable ATP-dependent RNA helicase DDX6	Regulated Protein	DDX6_HUMAN	[81]
	Protein FAM3C	Regulated Protein	FAM3C_HUMAN	[3]
	Protein FAM45A	Regulated Protein	FA45A_HUMAN	[3]
	Protein Jade-1	Regulated Protein	JADE1_HUMAN	[3]
	Protein jagged-1	Regulated Protein	JAG1_HUMAN	[82]
	Protein mono-ADP-ribosyltransferase PARP8	Regulated Protein	PARP8_HUMAN	[83]
	Protein NDRG2	Regulated Protein	NDRG2_HUMAN	[3]
	Protein NipSnap homolog 1	Regulated Protein	NIPS1_HUMAN	[3]
	Protein SET	Regulated Protein	SET_HUMAN	[34]
	Protein-arginine deiminase type-1	Regulated Protein	PADI1_HUMAN	[59]
	Ras-responsive element-binding protein 1	Regulated Protein	RREB1_HUMAN	[84]
	Replication protein A 70 kDa DNA-binding subunit	Regulated Protein	RFA1_HUMAN	[34]
Rhotekin	Regulated Protein	RTKN_HUMAN	[85]
Roundabout homolog 2	Regulated Protein	ROBO2_HUMAN	[86]
Serine incorporator 5	Regulated Protein	SERC5_HUMAN	[3]
Serine palmitoyltransferase 1	Regulated Protein	SPTC1_HUMAN	[34]
SLIT-ROBO Rho GTPase-activating protein 1	Regulated Protein	SRGP1_HUMAN	[86]
Sorting nexin-24	Regulated Protein	SNX24_HUMAN	[59]
Sterile alpha motif domain-containing protein 5	Regulated Protein	SAMD5_HUMAN	[59]
Suppressor of cytokine signaling 7	Regulated Protein	SOCS7_HUMAN	[87]
Switch-associated protein 70	Regulated Protein	SWP70_HUMAN	[88]
Tetraspanin-6	Regulated Protein	TSN6_HUMAN	[3]
Transcription factor SOX-9	Regulated Protein	SOX9_HUMAN	[69]
Transcription factor Sp7	Regulated Protein	SP7_HUMAN	[89]
Transcriptional regulator ERG	Regulated Protein	ERG_HUMAN	[90]
Transmembrane protein 9B	Regulated Protein	TMM9B_HUMAN	[3]
Tropomodulin-3	Regulated Protein	TMOD3_HUMAN	[83]
Tropomyosin alpha-3 chain	Regulated Protein	TPM3_HUMAN	[3]
Tumor protein p63-regulated gene 1 protein	Regulated Protein	TPRG1_HUMAN	[3]
Uncharacterized protein C11orf65	Regulated Protein	CK065_HUMAN	[3]
Unconventional myosin-Va	Regulated Protein	MYO5A_HUMAN	[91]
Unconventional myosin-VI	Regulated Protein	MYO6_HUMAN	[92]
Vacuolar protein sorting-associated protein 51 homolog	Regulated Protein	VPS51_HUMAN	[93]
References
REF 1	MiR-145 inhibits cell proliferation of human lung adenocarcinoma by targeting EGFR and NUDT1. RNA Biol. 2011 Jan-Feb;8(1):125-31.
REF 2	miR-145 participates with TP53 in a death-promoting regulatory loop and targets estrogen receptor-alpha in human breast cancer cells. Cell Death Differ. 2010 Feb;17(2):246-54.
REF 3	miR-145, miR-133a and miR-133b: Tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. Int J Cancer. 2010 Dec 15;127(12):2804-14.
REF 4	Analysis of the combined action of miR-143 and miR-145 on oncogenic pathways in colorectal cancer cells reveals a coordinate program of gene repression. Oncogene. 2013 Oct;32(40):4806-13.
REF 5	Human L-DOPA decarboxylase mRNA is a target of miR-145: A prediction to validation workflow. Gene. 2015 Jan 10;554(2):174-80.
REF 6	miR-145 induces caspase-dependent and -independent cell death in urothelial cancer cell lines with targeting of an expression signature present in Ta bladder tumors. Oncogene. 2010 Feb 18;29(7):1073-84.
REF 7	miRNA-145 inhibits non-small cell lung cancer cell proliferation by targeting c-Myc. J Exp Clin Cancer Res. 2010 Nov 22;29:151.
REF 8	miR-145 sensitizes ovarian cancer cells to paclitaxel by targeting Sp1 and Cdk6. Int J Cancer. 2014 Sep 15;135(6):1286-96.
REF 9	Mechanism of growth inhibition by MicroRNA 145: the role of the IGF-I receptor signaling pathway. J Cell Physiol. 2009 Aug;220(2):485-91.
REF 10	Direct conversion of fibroblasts to neurons by reprogramming PTB-regulated microRNA circuits. Cell. 2013 Jan 17;152(1-2):82-96.
REF 11	Regulation of cystic fibrosis transmembrane conductance regulator by microRNA-145, -223, and -494 is altered in F508 cystic fibrosis airway epithelium. J Immunol. 2013 Apr 1;190(7):3354-62.
REF 12	MicroRNA regulation of IFN-beta protein expression: rapid and sensitive modulation of the innate immune response. J Immunol. 2010 Mar 1;184(5):2369-76.
REF 13	MiR-145 inhibits tumor angiogenesis and growth by N-RAS and VEGF. Cell Cycle. 2012 Jun 1;11(11):2137-45.
REF 14	Identification of novel MicroRNA signatures linked to experimental autoimmune myasthenia gravis pathogenesis: down-regulated miR-145 promotes pathogenetic Th17 cell response. J Neuroimmune Pharmacol. 2013 Dec;8(5):1287-302.
REF 15	ROCK1, a novel target of miR-145, promotes glioma cell invasion. Mol Med Rep. 2014 May;9(5):1877-82.
REF 16	MiR-145 functions as a tumor suppressor by directly targeting histone deacetylase 2 in liver cancer. Cancer Lett. 2013 Jul 28;335(2):455-62.
REF 17	MiR-145 reduces ADAM17 expression and inhibits in vitro migration and invasion of glioma cells. Oncol Rep. 2013 Jan;29(1):67-72.
REF 18	MiR-145 is downregulated in human ovarian cancer and modulates cell growth and invasion by targeting p70S6K1 and MUC1. Biochem Biophys Res Commun. 2013 Nov 29;441(4):693-700.
REF 19	Loss of microRNA-143/145 disturbs cellular growth and apoptosis of human epithelial cancers by impairing the MDM2-p53 feedback loop. Oncogene. 2013 Jan 3;32(1):61-9.
REF 20	MicroRNA-145 targets YES and STAT1 in colon cancer cells. PLoS One. 2010 Jan 21;5(1):e8836.
REF 21	miR-145 functions as tumor suppressor and targets two oncogenes, ANGPT2 and NEDD9, in renal cell carcinoma. J Cancer Res Clin Oncol. 2014 Mar;140(3):387-97.
REF 22	miRNA-145 inhibits VSMC proliferation by targeting CD40. Sci Rep. 2016 Oct 12;6:35302.
REF 23	MicroRNA miR-145 inhibits proliferation, invasiveness, and stem cell phenotype of an initro endometriosis model by targeting multiple cytoskeletal elements and pluripotency factors. Fertil Steril. 2013 Apr;99(5):1346-1355.e5.
REF 24	Umbilical Cord-Derived Mesenchymal Stem Cell-Derived Exosomal MicroRNAs Suppress Myofibroblast Differentiation by Inhibiting the Transforming Growth Factor-/SMAD2 Pathway During Wound Healing. Stem Cells Transl Med. 2016 Oct;5(10):1425-1439.
REF 25	MiR-145 regulates PAK4 via the MAPK pathway and exhibits an antitumor effect in human colon cells. Biochem Biophys Res Commun. 2012 Oct 26;427(3):444-9.
REF 26	Expression patterns and regulatory functions of microRNAs during the initiation of primordial follicle development in the neonatal mouse ovary. Biol Reprod. 2013 Nov 27;89(5):126.
REF 27	APRIL induces cisplatin resistance in gastric cancer cells via activation of the NF-B pathway. Cell Physiol Biochem. 2015;35(2):571-85.
REF 28	MicroRNA-145 is downregulated in glial tumors and regulates glioma cell migration by targeting connective tissue growth factor. PLoS One. 2013;8(2):e54652.
REF 29	Putative tumor suppressor miR-145 inhibits colon cancer cell growth by targeting oncogene Friend leukemia virus integration 1 gene. Cancer. 2011 Jan 1;117(1):86-95.
REF 30	Identification of a hypoxia-regulated miRNA signature in bladder cancer and a role for miR-145 in hypoxia-dependent apoptosis. Br J Cancer. 2015 Aug 11;113(4):634-44.
REF 31	MicroRNA-145 suppresses cell invasion and metastasis by directly targeting mucin 1. Cancer Res. 2010 Jan 1;70(1):378-87.
REF 32	The molecular mechanism of microRNA-145 to suppress invasion-metastasis cascade in gastric cancer. Oncogene. 2013 Jan 24;32(4):491-501.
REF 33	MicroRNA-145 inhibits the growth, invasion, metastasis and angiogenesis of neuroblastoma cells through targeting hypoxia-inducible factor 2 alpha. Oncogene. 2014 Jan 16;33(3):387-97.
REF 34	Identification of miR-145 targets through an integrated omics analysis. Mol Biosyst. 2015 Jan;11(1):197-207.
REF 35	miR-145 and miR-133a function as tumour suppressors and directly regulate FSCN1 expression in bladder cancer. Br J Cancer. 2010 Mar 2;102(5):883-91.
REF 36	MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Cell. 2009 May 15;137(4):647-58.
REF 37	Type I IFN inhibits innate IL-10 production in macrophages through histone deacetylase 11 by downregulating microRNA-145. J Immunol. 2013 Oct 1;191(7):3896-904.
REF 38	Identification of miR-145 and miR-146a as mediators of the 5q- syndrome phenotype. Nat Med. 2010 Jan;16(1):49-58.
REF 39	Replacement treatment with microRNA-143 and -145 induces synergistic inhibition of the growth of human bladder cancer cells by regulating PI3K/Akt and MAPK signaling pathways. Cancer Lett. 2013 Jan 28;328(2):353-61.
REF 40	Prediction and preliminary validation of oncogene regulation by miRNAs. BMC Mol Biol. 2007 Sep 18;8:79.
REF 41	Tumor-suppressive microRNA-145 induces growth arrest by targeting SENP1 in human prostate cancer cells. Cancer Sci. 2015 Apr;106(4):375-82.
REF 42	MicroRNA-145 regulates human corneal epithelial differentiation. PLoS One. 2011;6(6):e21249.
REF 43	miR-145-dependent targeting of junctional adhesion molecule A and modulation of fascin expression are associated with reduced breast cancer cell motility and invasiveness. Oncogene. 2010 Dec 16;29(50):6569-80.
REF 44	miRNA-145 targets v-ets erythroblastosis virus E26 oncogene homolog 1 to suppress the invasion, metastasis, and angiogenesis of gastric cancer cells. Mol Cancer Res. 2013 Feb;11(2):182-93.
REF 45	Oncogenic Wip1 phosphatase is inhibited by miR-16 in the DNA damage signaling pathway. Cancer Res. 2010 Sep 15;70(18):7176-86.
REF 46	MiR-145, a new regulator of the DNA fragmentation factor-45 (DFF45)-mediated apoptotic network. Mol Cancer. 2010 Aug 6;9:211.
REF 47	NEDD9, a novel target of miR-145, increases the invasiveness of glioblastoma. Oncotarget. 2012 Jul;3(7):723-34.
REF 48	Micro RNA 145 targets the insulin receptor substrate-1 and inhibits the growth of colon cancer cells. J Biol Chem. 2007 Nov 9;282(45):32582-90.
REF 49	Screening key microRNAs for castration-resistant prostate cancer based on miRNA/mRNA functional synergistic network. Oncotarget. 2015 Dec 22;6(41):43819-30.
REF 50	MiR-145 acts as a metastasis suppressor by targeting metadherin in lung cancer. Med Oncol. 2015 Jan;32(1):344.
REF 51	miR-145, targeting high-mobility group A2, is a powerful predictor of patient outcome in ovarian carcinoma. Cancer Lett. 2015 Jan 28;356(2 Pt B):937-45.
REF 52	Elevated levels of miR-145 correlate with SMAD3 down-regulation in cystic fibrosis patients. J Cyst Fibros. 2013 Dec;12(6):797-802.
REF 53	MiR-145 inhibits cell proliferation of human lung adenocarcinoma by targeting EGFR and NUDT1. RNA Biol. 2011 Jan-Feb;8(1):125-31.
REF 54	Decreased expression of microRNA-143 and -145 in human gastric cancers. Oncology. 2009;77(1):12-21.
REF 55	miR-145, miR-133a and miR-133b: Tumor-suppressive miRNAs target FSCN1 in esophageal squamous cell carcinoma. Int J Cancer. 2010 Dec 15;127(12):2804-14.
REF 56	lincRNA-RoR and miR-145 regulate invasion in triple-negative breast cancer via targeting ARF6.Mol Cancer Res. 2015 Feb;13(2):330-8.
REF 57	Downregulation of microRNA-1 and microRNA-145 contributes synergistically to the development of colon cancer.Int J Mol Med. 2015 Dec;36(6):1630-8.
REF 58	MicroRNA145 targets BNIP3 and suppresses prostate cancer progression.Cancer Res. 2010 Apr 1;70(7):2728-38.
REF 59	MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 60	Stromal Expression of miR-143/145 Promotes Neoangiogenesis in Lung Cancer Development.Cancer Discov. 2016 Feb;6(2):188-201.
REF 61	Catenin-1, negatively regulated by miR-145, promotes tumour aggressiveness in gastric cancer.J Pathol. 2015 May;236(1):53-64.
REF 62	miR-145 induces caspase-dependent and -independent cell death in urothelial cancer cell lines with targeting of an expression signature present in Ta bladder tumors. Oncogene. 2010 Feb 18;29(7):1073-84.
REF 63	miRNA-145 is downregulated in atypical and anaplastic meningiomas and negatively regulates motility and proliferation of meningioma cells.Oncogene. 2013 Sep 26;32(39):4712-20.
REF 64	Putative tumor suppressor miR-145 inhibits colon cancer cell growth by targeting oncogene Friend leukemia virus integration 1 gene. Cancer. 2011 Jan 1;117(1):86-95.
REF 65	miR-145 sensitizes gallbladder cancer to cisplatin by regulating multidrug resistance associated protein 1.Tumour Biol. 2016 Aug;37(8):10553-62.
REF 66	Identification of miR-145 targets through an integrated omics analysis. Mol Biosyst. 2015 Jan;11(1):197-207.
REF 67	MiRNA-145 Regulates the Development of Congenital Heart Disease Through Targeting FXN.Pediatr Cardiol. 2016 Apr;37(4):629-36.
REF 68	EWS-FLI-1 modulates miRNA145 and SOX2 expression to initiate mesenchymal stem cell reprogramming toward Ewing sarcoma cancer stem cells.Genes Dev. 2010 May;24(9):916-32.
REF 69	MiR-145 functions as a tumor-suppressive RNA by targeting Sox9 and adducin 3 in human glioma cells.Neuro Oncol. 2013 Oct;15(10):1302-16.
REF 70	MicroRNA-126 regulates HOXA9 by binding to the homeobox.Mol Cell Biol. 2008 Jul;28(14):4609-19.
REF 71	Endogenous miRNA sponge lincRNA-RoR regulates Oct4, Nanog, and Sox2 in human embryonic stem cell self-renewal. Dev Cell. 2013 Apr 15;25(1):69-80.
REF 72	MiR-145 modulates multiple components of the insulin-like growth factor pathway in hepatocellular carcinoma. Carcinogenesis. 2012 Jun;33(6):1134-41.
REF 73	Identification of novel microRNA targets based on microRNA signatures in bladder cancer.Int J Cancer. 2009 Jul 15;125(2):345-52.
REF 74	Analysis of the combined action of miR-143 and miR-145 on oncogenic pathways in colorectal cancer cells reveals a coordinate program of gene repression. Oncogene. 2013 Oct;32(40):4806-13.
REF 75	Umbilical Cord-Derived Mesenchymal Stem Cell-Derived Exosomal MicroRNAs Suppress Myofibroblast Differentiation by Inhibiting the Transforming Growth Factor-/SMAD2 Pathway During Wound Healing. Stem Cells Transl Med. 2016 Oct;5(10):1425-1439.
REF 76	Angiotensin II Downregulates MicroRNA-145 to Regulate Kruppel-like Factor 4 and Myocardin Expression in Human Coronary Arterial Smooth Muscle Cells under High Glucose Conditions. Mol Med. 2015 Jul 14;21:616-25.
REF 77	Identification of novel MicroRNA signatures linked to experimental autoimmune myasthenia gravis pathogenesis: down-regulated miR-145 promotes pathogenetic Th17 cell response. J Neuroimmune Pharmacol. 2013 Dec;8(5):1287-302.
REF 78	MicroRNA-145 suppresses cell migration and invasion by targeting paxillin in human colorectal cancer cells. Int J Clin Exp Pathol. 2015 Feb 1;8(2):1328-40.
REF 79	MicroRNA-145 regulates OCT4, SOX2, and KLF4 and represses pluripotency in human embryonic stem cells. Cell. 2009 May 15;137(4):647-58.
REF 80	Forced expression of miR-143 represses ERK5/c-Myc and p68/p72 signaling in concert with miR-145 in gut tumors of Apc(Min) mice.PLoS One. 2012;7(8):e42137.
REF 81	DDX6 post-transcriptionally down-regulates miR-143/145 expression through host gene NCR143/145 in cancer cells.Biochim Biophys Acta. 2013 Oct;1829(10):1102-10.
REF 82	The miR-143/145 cluster is a novel transcriptional target of Jagged-1/Notch signaling in vascular smooth muscle cells.J Biol Chem. 2011 Aug 12;286(32):28312-21.
REF 83	A combined computational-experimental approach predicts human microRNA targets. Genes Dev. 2004 May 15;18(10):1165-78.
REF 84	RREB1 repressed miR-143/145 modulates KRAS signaling through downregulation of multiple targets.Oncogene. 2013 May 16;32(20):2576-85.
REF 85	miR-145 inhibits breast cancer cell growth through RTKN.Int J Oncol. 2009 May;34(5):1461-6.
REF 86	MicroRNAs 144, 145, and 214 are down-regulated in primary neurons responding to sciatic nerve transection.Brain Res. 2011 Apr 6;1383:62-70.
REF 87	socs7, a target gene of microRNA-145, regulates interferon- induction through STAT3 nuclear translocation in bladder cancer cells.Cell Death Dis. 2013 Feb 7;4:e482.
REF 88	SWAP70, actin-binding protein, function as an oncogene targeting tumor-suppressive miR-145 in prostate cancer.Prostate. 2011 Oct 1;71(14):1559-67.
REF 89	miR-145 suppresses osteogenic differentiation by targeting Sp7.FEBS Lett. 2013 Sep 17;587(18):3027-31.
REF 90	The proto-oncogene ERG is a target of microRNA miR-145 in prostate cancer.FEBS J. 2013 May;280(9):2105-16.
REF 91	Identification of miR-145 as a key regulator of the pigmentary process.J Invest Dermatol. 2013 Jan;133(1):201-9.
REF 92	The microRNA profile of prostate carcinoma obtained by deep sequencing.Mol Cancer Res. 2010 Apr;8(4):529-38.
REF 93	MiR-145 functions as a tumor suppressor via regulating angiopoietin-2 in pancreatic cancer cells.Cancer Cell Int. 2016 Aug 25;16(1):65.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.