miRNA General Information
miRNA Mature ID	hsa-miR-744-5p
miRNA Stemloop AC	MI0005559
miRNA Stemloop ID	hsa-mir-744
Sequence	ugcggggcuagggcuaacagca
TTD Target(s) Regulated by This miRNA	Glycogen synthase kinase-3 beta (GSK-3B)	Clinical trial Target	Target Info	[1]
	Proto-oncogene c-Myc (MYC)	Literature-reported Target	Target Info	[2]
Protein(s) Regulated by This miRNA	Elongation factor 1-alpha 2	Regulated Protein	EF1A2_HUMAN	[3]
	Protein naked cuticle homolog 1	Regulated Protein	NKD1_HUMAN	[1]
	Rho GTPase-activating protein 5	Regulated Protein	RHG05_HUMAN	[5]
	Secreted frizzled-related protein 1	Regulated Protein	SFRP1_HUMAN	[1]
	Transducin-like enhancer protein 3	Regulated Protein	TLE3_HUMAN	[1]
References
REF 1	MicroRNA-744 promotes prostate cancer progression through aberrantly activating Wnt/-catenin signaling. Oncotarget. 2017 Feb 28;8(9):14693-14707.
REF 2	Decrease expression of microRNA-744 promotes cell proliferation by targeting c-Myc in human hepatocellular carcinoma. Cancer Cell Int. 2014 Jun 22;14:58.
REF 3	Proto-oncogenic isoform A2 of eukaryotic translation elongation factor eEF1 is a target of miR-663 and miR-744.Br J Cancer. 2013 Jun 11;108(11):2304-11.
REF 4	MicroRNA-744 promotes prostate cancer progression through aberrantly activating Wnt/-catenin signaling. Oncotarget. 2017 Feb 28;8(9):14693-14707.
REF 5	MiR-744 functions as a proto-oncogene in nasopharyngeal carcinoma progression and metastasis via transcriptional control of ARHGAP5.Oncotarget. 2015 May 30;6(15):13164-75.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.