miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-451a | ||||
| miRNA Stemloop AC | MI0001729 | ||||
| miRNA Stemloop ID | hsa-mir-451a | ||||
| Sequence | aaaccguuaccauuacugaguu | ||||
| miRNA General Information | |||||
| miRNA Mature ID | hsa-miR-451a | ||||
| miRNA Stemloop AC | MI0001729 | ||||
| miRNA Stemloop ID | hsa-mir-451 | ||||
| Sequence | aaaccguuaccauuacugaguu | ||||
| TTD Target(s) Regulated by This miRNA | Matrix metalloproteinase-2 (MMP-2) | Successful Target | Target Info | [1] | |
| Multidrug resistance protein 1 (ABCB1) | Clinical trial Target | Target Info | [2] | ||
| Apoptosis regulator Bcl-2 (BCL-2) | Successful Target | Target Info | [1] | ||
| Interleukin-6 (IL6) | Successful Target | Target Info | [3] | ||
| Oxytocin receptor (OTR) | Successful Target | Target Info | [4] | ||
| Matrix metalloproteinase-9 (MMP-9) | Clinical trial Target | Target Info | [1] | ||
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [1] | ||
| Extracellular signal-regulated kinase 2 (ERK2) | Clinical trial Target | Target Info | [5] | ||
| Inhibitor of nuclear factor kappa-B kinase beta (IKKB) | Clinical trial Target | Target Info | [6] | ||
| Macrophage migration inhibitory factor (MIF) | Clinical trial Target | Target Info | [7] | ||
| Mammalian disintegrin-metalloprotease (ADAM10) | Clinical trial Target | Target Info | [8] | ||
| MAPK/ERK kinase kinase 1 (MAP3K1) | Clinical trial Target | Target Info | [9] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [10] | ||
| Protein(s) Regulated by This miRNA | Calcium-binding protein 39 | Regulated Protein | [11] | ||
| Copine-3 | Regulated Protein | [12] | |||
| Cyclin-dependent kinase 4 inhibitor D | Regulated Protein | [9] | |||
| Discoidin, CUB and LCCL domain-containing protein 2 | Regulated Protein | [14] | |||
| Hamartin | Regulated Protein | [15] | |||
| Interleukin-6 receptor subunit alpha | Regulated Protein | [16] | |||
| Polycystin-1 | Regulated Protein | [17] | |||
| Protein odd-skipped-related 1 | Regulated Protein | [17] | |||
| Ras-related protein Rab-14 | Regulated Protein | [18] | |||
| Ras-related protein Rab-5A | Regulated Protein | [12] | |||
| Secreted frizzled-related protein 3 | Regulated Protein | [17] | |||
| Transmembrane emp24 domain-containing protein 7 | Regulated Protein | [1] | |||
| Tyrosine-protein kinase transmembrane receptor ROR2 | Regulated Protein | [17] | |||
| References | |||||
| REF 1 | MiRNA-451 plays a role as tumor suppressor in human glioma cells. Brain Res. 2010 Nov 4;1359:14-21. | ||||
| REF 2 | Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. | ||||
| REF 3 | miR-451 acts as a suppressor of angiogenesis in hepatocellular carcinoma by targeting the IL-6R-STAT3 pathway. Oncol Rep. 2016 Sep;36(3):1385-92. | ||||
| REF 4 | Hypomethylation of miR-142 promoter and upregulation of microRNAs that target the oxytocin receptor gene in the autism prefrontal cortex. Mol Autism. 2015 Aug 14;6:46. | ||||
| REF 5 | High-Throughput Screening Identifies miR-451 as a Pleiotropic Modulator That Suppresses Gastric Cancer Metastasis. SLAS Technol. 2017 Apr;22(2):136-143. | ||||
| REF 6 | miR-451 inhibits cell proliferation in human hepatocellular carcinoma through direct suppression of IKK-. Carcinogenesis. 2013 Nov;34(11):2443-51. | ||||
| REF 7 | microRNA-451 regulates macrophage migration inhibitory factor production and proliferation of gastrointestinal cancer cells. Clin Cancer Res. 2009 Apr 1;15(7):2281-90. | ||||
| REF 8 | Transcriptional control of PAX4-regulated miR-144/451 modulates metastasis by suppressing ADAMs expression. Oncogene. 2015 Jun;34(25):3283-95. | ||||
| REF 9 | MiR-451 inhibits proliferation of esophageal carcinoma cell line EC9706 by targeting CDKN2D and MAP3K1. World J Gastroenterol. 2015 May 21;21(19):5867-76. | ||||
| REF 10 | MicroRNA-451 induces epithelial-mesenchymal transition in docetaxel-resistant lung adenocarcinoma cells by targeting proto-oncogene c-Myc. Eur J Cancer. 2014 Nov;50(17):3050-67. | ||||
| REF 11 | MicroRNA-451 regulates LKB1/AMPK signaling and allows adaptation to metabolic stress in glioma cells.Mol Cell. 2010 Mar 12;37(5):620-32. | ||||
| REF 12 | MicroRNA-451 down-regulates neutrophil chemotaxis via p38 MAPK.Arthritis Rheumatol. 2014 Mar;66(3):549-59. | ||||
| REF 13 | MiR-451 inhibits proliferation of esophageal carcinoma cell line EC9706 by targeting CDKN2D and MAP3K1. World J Gastroenterol. 2015 May 21;21(19):5867-76. | ||||
| REF 14 | Identification of tumour suppressive microRNA-451a in hypopharyngeal squamous cell carcinoma based on microRNA expression signature.Br J Cancer. 2014 Jul 15;111(2):386-94. | ||||
| REF 15 | miR-101-2, miR-125b-2 and miR-451a act as potential tumor suppressors in gastric cancer through regulation of the PI3K/AKT/mTOR pathway.Cell Oncol (Dordr). 2016 Feb;39(1):23-33. | ||||
| REF 16 | MicroRNA-451 suppresses tumor cell growth by down-regulating IL6R gene expression.Cancer Epidemiol. 2014 Feb;38(1):85-92. | ||||
| REF 17 | MicroRNA expression profiling and target genes study in congenital microtia. Int J Pediatr Otorhinolaryngol. 2013 Apr;77(4):483-7. | ||||
| REF 18 | MicroRNA-451 functions as a tumor suppressor in human non-small cell lung cancer by targeting ras-related protein 14 (RAB14).Oncogene. 2011 Jun 9;30(23):2644-58. | ||||
| REF 19 | MiRNA-451 plays a role as tumor suppressor in human glioma cells. Brain Res. 2010 Nov 4;1359:14-21. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.