miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-let-7g-5p | ||||
| miRNA Stemloop AC | MI0000433 | ||||
| miRNA Stemloop ID | hsa-let-7g | ||||
| Sequence | ugagguaguaguuuguacaguu | ||||
| TTD Target(s) Regulated by This miRNA | TGF-beta receptor type I (TGFBR1) | Clinical trial Target | Target Info | [1] | |
| Apoptosis regulator Bcl-xL (BCL-xL) | Clinical trial Target | Target Info | [2] | ||
| Caspase-3 (CASP3) | Clinical trial Target | Target Info | [3] | ||
| Fibronectin (FN1) | Clinical trial Target | Target Info | [4] | ||
| Interleukin-13 (IL13) | Successful Target | Target Info | [5] | ||
| TRAIL receptor 2 (TRAIL-R2) | Clinical trial Target | Target Info | [6] | ||
| Collagen I (COL1A2) | Clinical trial Target | Target Info | [7] | ||
| Thrombospondin-1 (THBS1) | Clinical trial Target | Target Info | [1] | ||
| Proto-oncogene c-Myc (MYC) | Literature-reported Target | Target Info | [8] | ||
| RAC-beta serine/threonine-protein kinase (AKT2) | Literature-reported Target | Target Info | [9] | ||
| Epithelial discoidin domain receptor 1 (DDR1) | Patented-recorded Target | Target Info | [10] | ||
| Polycomb complex protein BMI-1 (BMI1) | Clinical trial Target | Target Info | [8] | ||
| Multiple tumor suppressor 1 (CDKN2A) | Literature-reported Target | Target Info | [8] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [11] | ||
| Protein(s) Regulated by This miRNA | GRB2-associated-binding protein 2 | Regulated Protein | [4] | ||
| Insulin-like growth factor 2 mRNA-binding protein 1 | Regulated Protein | [13] | |||
| Mothers against decapentaplegic homolog 2 | Regulated Protein | [1] | |||
| Protein argonaute-1 | Regulated Protein | [15] | |||
| TBC1 domain family member 9 | Regulated Protein | [16] | |||
| References | |||||
| REF 1 | Let-7g improves multiple endothelial functions through targeting transforming growth factor-beta and SIRT-1 signaling. J Am Coll Cardiol. 2014 Apr 29;63(16):1685-94. | ||||
| REF 2 | The let-7 family of microRNAs inhibits Bcl-xL expression and potentiates sorafenib-induced apoptosis in human hepatocellular carcinoma. J Hepatol. 2010 May;52(5):698-704. | ||||
| REF 3 | Hsa-let-7g miRNA targets caspase-3 and inhibits the apoptosis induced by ox-LDL in endothelial cells. Int J Mol Sci. 2013 Nov 18;14(11):22708-20. | ||||
| REF 4 | Pivotal role of reduced let-7g expression in breast cancer invasion and metastasis. Cancer Res. 2011 Oct 15;71(20):6463-74. | ||||
| REF 5 | Let-7 microRNA-mediated regulation of IL-13 and allergic airway inflammation. J Allergy Clin Immunol. 2011 Nov;128(5):1077-85.e1-10. | ||||
| REF 6 | Nuclear death receptor TRAIL-R2 inhibits maturation of let-7 and promotes proliferation of pancreatic and other tumor cells. Gastroenterology. 2014 Jan;146(1):278-90. | ||||
| REF 7 | Let-7g targets collagen type I alpha2 and inhibits cell migration in hepatocellular carcinoma. J Hepatol. 2010 May;52(5):690-7. | ||||
| REF 8 | Hsa-let-7g inhibits proliferation of hepatocellular carcinoma cells by downregulation of c-Myc and upregulation of p16(INK4A). Int J Cancer. 2011 Jan 15;128(2):319-31. | ||||
| REF 9 | let-7b/g silencing activates AKT signaling to promote gastric carcinogenesis. J Transl Med. 2014 Oct 5;12:281. | ||||
| REF 10 | Hsa-let-7g miRNA regulates the anti-tumor effects of gastric cancer cells under oxidative stress through the expression of DDR genes. J Toxicol Sci. 2015 Jun;40(3):329-38. | ||||
| REF 11 | High mobility group A2 is a target for miRNA-98 in head and neck squamous cell carcinoma. Mol Cancer. 2007 Jan 14;6:5. | ||||
| REF 12 | Pivotal role of reduced let-7g expression in breast cancer invasion and metastasis. Cancer Res. 2011 Oct 15;71(20):6463-74. | ||||
| REF 13 | Identification of let-7-regulated oncofetal genes. Cancer Res. 2008 Apr 15;68(8):2587-91. | ||||
| REF 14 | Let-7g improves multiple endothelial functions through targeting transforming growth factor-beta and SIRT-1 signaling. J Am Coll Cardiol. 2014 Apr 29;63(16):1685-94. | ||||
| REF 15 | Hypoxia-responsive miRNAs target argonaute 1 to promote angiogenesis.J Clin Invest. 2013 Mar;123(3):1057-67. | ||||
| REF 16 | Let-7 modulates acquired resistance of ovarian cancer to Taxanes via IMP-1-mediated stabilization of multidrug resistance 1. Int J Cancer. 2012 Apr 15;130(8):1787-97. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.