miRNA General Information
miRNA Mature ID	hsa-miR-19b-2-5p
miRNA Stemloop AC	MI0000075
miRNA Stemloop ID	hsa-mir-19b-2
Sequence	aguuuugcagguuugcauuuca
TTD Target(s) Regulated by This miRNA	Proto-oncogene c-Myc (MYC)	Literature-reported Target	Target Info	[1]
References
REF 1	Upregulation of the miR-17-92 cluster and its two paraloga in osteosarcoma - reasons and consequences. Genes Cancer. 2014 Apr;5(1-2):56-63.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.