Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T12355 Target Info
Target Name G1/S-specific cyclin-D1 (CCND1)
Synonyms PRAD1 oncogene; PRAD1; Cyclin D1; BCL1; BCL-1 oncogene; BCL-1; B-cell lymphoma 1 protein
Target Type Clinical trial Target
Gene Name CCND1
UniProt ID
P24385
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-195-5p miRNA Info
miRNA Mature AC
MIMAT0000461
Sequence uagcagcacagaaauauuggc
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-195-5p resulted in the decreased protein level of target CCND1. [2]
Evidence Score (E-score) 6 +
1 Immunohistochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [1]
2 Immunohistochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [2]
3 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay [4]
5 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
6 Luciferase Reporter Assay; Western Blot [6]
Representative Target(s) Regulated by This miRNA ADP-ribosylation factor-like protein 2 (ARL2) Target Info
ARL2_HUMAN
Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
miRNA Mature ID hsa-miR-193b-3p miRNA Info
miRNA Mature AC
MIMAT0002819
Sequence aacuggcccucaaagucccgcu
miRNA Species Homo sapiens
Regulation Mechanism miR-193b directly regulates CCND1 by binding to the 3'UTR of CCND1 mRNA. [10]
Evidence Score (E-score) 5 +
1 Immunohistochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [7]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
3 Luciferase Reporter Assay; Western Blot [9]
4 Luciferase Reporter Assay; Western Blot [10]
5 Western Blot; qRT-PCR [11]
Representative Target(s) Regulated by This miRNA DNA repair protein RAD51 homolog 1 (RAD51) Target Info
RAD51_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-34a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target CCND1. [2]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay [12]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [13]
4 qRT-PCR; Luciferase Reporter Assay; Western Blot [14]
5 qRT-PCR; Western Blot [15]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-15a-5p miRNA Info
miRNA Mature AC
MIMAT0000068
Sequence uagcagcacauaaugguuugug
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-15a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target CCND1. [2]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay [16]
2 Luciferase Reporter Assay [17]
3 Luciferase Reporter Assay [2]
4 Luciferase Reporter Assay; Western Blot [18]
5 qRT-PCR; Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-20a-5p resulted in the unchanged mRNA level of target CCND1. [2]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [20]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [21]
4 qRT-PCR; Western Blot [22]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-503-5p by mature miRNA precursor transfection resulted in the decreased protein level of target CCND1. [2]
Evidence Score (E-score) 4 +
1 Immunohistochemistry; Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot [23]
2 Immunohistochemistry; Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay [24]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [25]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
MIMAT0000063
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Immunoblot; Immunofluorescent Assay; Luciferase Reporter Assay; qRT-PCR; Reporter Assay [2]
2 Immunoblot; Luciferase Reporter Assay; Northern Blot; Western Blot [26]
3 Immunoblot; Microarray; qRT-PCR; Western Blot [27]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauaggggu
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [28]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; Western Blot [29]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-17-5p resulted in the unchanged mRNA level of target CCND1. [2]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [20]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [21]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-302a-3p miRNA Info
miRNA Mature AC
MIMAT0000684
Sequence uaagugcuuccauguuuugguga
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-302a-3p by Anti-miRNA Oligonucleotide resulted in the changed protein level of target CCND1. [2]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; Microarray; Northern Blot; Western Blot [30]
2 Luciferase Reporter Assay; Microarray; Northern Blot; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [31]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
miRNA Mature ID hsa-miR-365a-3p miRNA Info
miRNA Mature AC
MIMAT0000710
Sequence uaaugccccuaaaaauccuuau
miRNA Species Homo sapiens
Regulation Mechanism Activation of Akt suppresses the abundance of p53, leading to decreased transcription of miR-365, thus causing upregulation of cyclin D1 and cdc25A, which promotes gastric cell proliferation/PTEN-Akt-p53-miR-365-cyclin D1/cdc25A axis serves as a new mechanism underlying gastric tumorigenesis, providing potential new therapeutic targets. [33]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; Western Blot [32]
2 Luciferase Reporter Assay; Western Blot [33]
3 Luciferase Reporter Assay; Western Blot [34]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-let-7e-5p miRNA Info
miRNA Mature AC
MIMAT0000066
Sequence ugagguaggagguuguauaguu
miRNA Species Homo sapiens
Regulation Mechanism Cyclin D1 is a direct target of let-7e. [35]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [35]
2 qRT-PCR; Western Blot [36]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Aurora kinase B (AURKB) Target Info
AURKB_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 PAR-CLIP [37]
2 qRT-PCR; Western Blot [22]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [20]
2 PAR-CLIP [37]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-15b-5p miRNA Info
miRNA Mature AC
MIMAT0000417
Sequence uagcagcacaucaugguuuaca
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [38]
2 qRT-PCR; Western Blot [39]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-19a-3p resulted in the decreased protein level of target CCND1. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [40]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-206 miRNA Info
miRNA Mature AC
MIMAT0000462
Sequence uggaauguaaggaagugugugg
miRNA Species Homo sapiens
Regulation Mechanism Cyclin D1 is a major target of miR-206 in cell differentiation and transformation. [41]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [41]
2 Luciferase Reporter Assay; Western Blot [42]
Representative Target(s) Regulated by This miRNA Annexin A2 (ANXA2) Target Info
ANXA2_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-20b-5p miRNA Info
miRNA Mature AC
MIMAT0001413
Sequence caaagugcucauagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunoblot; Immunoprecipitation; qRT-PCR [43]
2 PAR-CLIP [37]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-302c-3p miRNA Info
miRNA Mature AC
MIMAT0000717
Sequence uaagugcuuccauguuucagugg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-302c-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target CCND1. [2]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; Northern Blot; Western Blot [30]
2 Luciferase Reporter Assay; Microarray; Northern Blot; Western Blot [2]
Representative Target(s) Regulated by This miRNA Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-338-3p miRNA Info
miRNA Mature AC
MIMAT0000763
Sequence uccagcaucagugauuuuguug
miRNA Species Homo sapiens
Regulation Mechanism CyclinD1 is a Direct Target of miR-338-3p, and the Effect of miR-338-3p on CyclinD1 is Mainly Dependent on the CyclinD1-39-UTR Region. [45]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [44]
2 Luciferase Reporter Assay [45]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-340-5p miRNA Info
miRNA Mature AC
MIMAT0004692
Sequence uuauaaagcaaugagacugauu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [46]
2 PAR-CLIP [37]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-374a-5p miRNA Info
miRNA Mature AC
MIMAT0000727
Sequence uuauaauacaaccugauaagug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [47]
2 PAR-CLIP [37]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
CCAAT/enhancer binding protein beta (CEBPB) Target Info
CEBPB_HUMAN
miRNA Mature ID hsa-miR-383-5p miRNA Info
miRNA Mature AC
MIMAT0000738
Sequence agaucagaaggugauuguggcu
miRNA Species Homo sapiens
Regulation Mechanism miR-383 dramatically reduced WT Cyclin D1 3'UTR reporter activity, whereas inhibition of miR-383 had the opposite effect and Cyclin D1 is a direct target of miR-383. [49]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [48]
2 Luciferase Reporter Assay; Western Blot [49]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-424-5p miRNA Info
miRNA Mature AC
MIMAT0001341
Sequence cagcagcaauucauguuuugaa
miRNA Species Homo sapiens
Regulation Mechanism CCND1 was the target of miR-424. [24]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [24]
2 qRT-PCR; Luciferase Reporter Assay; Western Blot [50]
Representative Target(s) Regulated by This miRNA Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
Cyclin D (CCND3) Target Info
CCND3_HUMAN
miRNA Mature ID hsa-miR-425-5p miRNA Info
miRNA Mature AC
MIMAT0003393
Sequence aaugacacgaucacucccguuga
miRNA Species Homo sapiens
Regulation Mechanism miR-425-5p bind specifically to the 3'UTR region of CCND1, blocking its transcription. [37]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [51]
2 Sequencing [37]
Representative Target(s) Regulated by This miRNA Fibroblast growth factor receptor 3 (FGFR3) Target Info
FGFR3_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Regulation Mechanism miR-449a can regulate Rb phosphorylation by directly targeting Cyclin D1. [52]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [52]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [53]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-603 miRNA Info
miRNA Mature AC
MIMAT0003271
Sequence cacacacugcaauuacuuuugc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [54]
2 PAR-CLIP; HITS-CLIP [55]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
Insulin-like growth factor-I (IGF1) Target Info
IGF1_HUMAN
miRNA Mature ID hsa-miR-95-3p miRNA Info
miRNA Mature AC
MIMAT0000094
Sequence uucaacggguauuuauugagca
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [56]
2 PAR-CLIP [37]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
miRNA Mature ID hsa-miR-3940-5p miRNA Info
miRNA Mature AC
MIMAT0019229
Sequence guggguuggggcgggcucug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 qRT-PCR; Western Blot [57]
2 qRT-PCR; Western Blot [2]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Regulation Mechanism miR-146a-5p inhibits cell proliferation and cell cycle progression in NSCLC cell lines by targeting CCND1. [58]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [58]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-152-3p miRNA Info
miRNA Mature AC
MIMAT0000438
Sequence ucagugcaugacagaacuugg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [51]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Dickkopf-related protein 1 (DKK1) Target Info
DKK1_HUMAN
miRNA Mature ID hsa-miR-16-1-3p miRNA Info
miRNA Mature AC
MIMAT0004489
Sequence ccaguauuaacugugcugcuga
miRNA Species Homo sapiens
Regulation Mechanism miR-16-1 regulates CCND1 protein expression and truncation of the 3' UTR occurs in MCL cell lines preventing proper miR-16-1 regulation of CCND1. [59]
Evidence Score (E-score) 1 +
1 GFP Reporter Assay; Western Blot [59]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-16-5p miRNA Info
miRNA Mature AC
MIMAT0000069
Sequence uagcagcacguaaauauuggcg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-16-5p resulted in the decreased protein level of target CCND1. [2]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR; Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Corticotropin-releasing factor binding protein (CRHBP) Target Info
CRHBP_HUMAN
miRNA Mature ID hsa-miR-193a-3p miRNA Info
miRNA Mature AC
MIMAT0000459
Sequence aacuggccuacaaagucccagu
miRNA Species Homo sapiens
Regulation Mechanism CCND1 expression was directly regulated by miR-193a-3p in breast cancer cells. [60]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [60]
Representative Target(s) Regulated by This miRNA E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-19b-1-5p miRNA Info
miRNA Mature AC
MIMAT0004491
Sequence aguuuugcagguuugcauccagc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [61]
Representative Target(s) Regulated by This miRNA Caspase-8 (CASP8) Target Info
CASP8_HUMAN
Fibroblast growth factor receptor 2 (FGFR2) Target Info
FGFR2_HUMAN
miRNA Mature ID hsa-miR-211-5p miRNA Info
miRNA Mature AC
MIMAT0000268
Sequence uucccuuugucauccuucgccu
miRNA Species Homo sapiens
Regulation Mechanism miR-211 targets CDK6 by binding to its 3'UTR. [62]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [62]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Calcium-activated potassium channel KCa1.1 (KCNMA1) Target Info
KCMA1_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism Downregulation of miR-27a could significantly decrease the transcriptional activity of cyclin D1. [63]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [63]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-296-5p miRNA Info
miRNA Mature AC
MIMAT0000690
Sequence agggcccccccucaauccugu
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-296-5p resulted in the changed protein level of target CCND1. [2]
Evidence Score (E-score) 1 +
1 Western Blot; qRT-PCR [2]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
miRNA Mature ID hsa-miR-29a-3p miRNA Info
miRNA Mature AC
MIMAT0000086
Sequence uagcaccaucugaaaucgguua
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [64]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Aryl hydrocarbon receptor (AHR) Target Info
AHR_HUMAN
miRNA Mature ID hsa-miR-34a-3p miRNA Info
miRNA Mature AC
MIMAT0004557
Sequence caaucagcaaguauacugcccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [65]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-34b-3p miRNA Info
miRNA Mature AC
MIMAT0004676
Sequence caaucacuaacuccacugccau
miRNA Species Homo sapiens
Regulation Mechanism miR-34b inhibits cell growth by targeting cyclin D1. [66]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [66]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-490-3p miRNA Info
miRNA Mature AC
MIMAT0002806
Sequence caaccuggaggacuccaugcug
miRNA Species Homo sapiens
Regulation Mechanism miR-490-3p inhibits proliferation of A549 lung cancer cells by targeting CCND1. [67]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [67]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
miRNA Mature ID hsa-miR-520a-3p miRNA Info
miRNA Mature AC
MIMAT0002834
Sequence aaagugcuucccuuuggacugu
miRNA Species Homo sapiens
Regulation Mechanism CCND1 is the direct target genes of miR-520a-3p. [68]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [68]
Representative Target(s) Regulated by This miRNA Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-708-5p miRNA Info
miRNA Mature AC
MIMAT0004926
Sequence aaggagcuuacaaucuagcuggg
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-708 reduced the expression of CCND1 in A172 and T98G cells. [69]
Evidence Score (E-score) 1 +
1 Western Blot [69]
Representative Target(s) Regulated by This miRNA Apoptosis inhibitor survivin (BIRC5) Target Info
BIRC5_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-892b miRNA Info
miRNA Mature AC
MIMAT0004918
Sequence cacuggcuccuuucuggguaga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Immunoblot [70]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-2861 miRNA Info
miRNA Mature AC
MIMAT0013802
Sequence ggggccuggcggugggcgg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [71]
Representative Target(s) Regulated by This miRNA Epidermal growth factor receptor (EGFR) Target Info
EGFR_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-576-3p miRNA Info
miRNA Mature AC
MIMAT0004796
Sequence aagauguggaaaaauuggaauc
miRNA Species Homo sapiens
Regulation Mechanism Expression of CCND1 on mRNA and protein levels were remarkably decreased after the overexpression of miR-576-3p. [72]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot; Luciferase Reporter Assay [72]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
References  Top
REF 1 MicroRNA profiling identifies MiR-195 suppresses osteosarcoma cell metastasis by targeting CCND1. Oncotarget. 2015 Apr 20;6(11):8875-89.
REF 2 MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57.
REF 3 Prognostic implications of micoRNA miR-195 expression in human tongue squamous cell carcinoma. PLoS One. 2013;8(2):e56634.
REF 4 MicroRNA-195 inhibits the proliferation of human glioma cells by directly targeting cyclin D1 and cyclin E1. PLoS One. 2013;8(1):e54932.
REF 5 MicroRNA-195-5p is a potential diagnostic and therapeutic target for breast cancer. Oncol Rep. 2014 Mar;31(3):1096-102.
REF 6 MicroRNA-195 plays a tumor-suppressor role in human glioblastoma cells by targeting signaling pathways involved in cellular proliferation and invasion. Neuro Oncol. 2012 Mar;14(3):278-87.
REF 7 Epigenetically altered miR-193b targets cyclin D1 in prostate cancer. Cancer Med. 2015 Sep;4(9):1417-25.
REF 8 MicroRNA-193b regulates proliferation, migration and invasion in human hepatocellular carcinoma cells. Eur J Cancer. 2010 Oct;46(15):2828-36.
REF 9 MiR-193b Mediates CEBPD-Induced Cisplatin Sensitization Through Targeting ETS1 and Cyclin D1 in Human Urothelial Carcinoma Cells. J Cell Biochem. 2017 Jun;118(6):1563-1573.
REF 10 MicroRNA-193b represses cell proliferation and regulates cyclin D1 in melanoma. Am J Pathol. 2010 May;176(5):2520-9.
REF 11 MicroRNA-193b inhibits the proliferation, migration and invasion of gastric cancer cells via targeting cyclin D1. Acta Histochem. 2016 May;118(4):323-30.
REF 12 The miR-34 family in cancer and apoptosis. Cell Death Differ. 2010 Feb;17(2):193-9.
REF 13 Downregulation of miR-34a contributes to the proliferation and migration of laryngeal carcinoma cells by targeting cyclin D1. Oncol Rep. 2016 Jul;36(1):390-8.
REF 14 Downregulation of CCND1 and CDK6 by miR-34a induces cell cycle arrest. FEBS Lett. 2008 Apr 30;582(10):1564-8.
REF 15 Prognostic significance of differentially expressed miRNAs in esophageal cancer. Int J Cancer. 2011 Jan 1;128(1):132-43.
REF 16 miR-15a and miR-16 are implicated in cell cycle regulation in a Rb-dependent manner and are frequently deleted or down-regulated in non-small cell lung cancer. Cancer Res. 2009 Jul 1;69(13):5553-9.
REF 17 The miR-15a-miR-16-1 cluster controls prostate cancer by targeting multiple oncogenic activities. Nat Med. 2008 Nov;14(11):1271-7.
REF 18 CDK4 and miR-15a comprise an abnormal automodulatory feedback loop stimulating the pathogenesis and inducing chemotherapy resistance in nasopharyngeal carcinoma. BMC Cancer. 2016 Mar 18;16:238.
REF 19 DLEU2, frequently deleted in malignancy, functions as a critical host gene of the cell cycle inhibitory microRNAs miR-15a and miR-16-1. Exp Cell Res. 2009 Oct 15;315(17):2941-52.
REF 20 MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoS One. 2011 Jan 20;6(1):e16138.
REF 21 A cyclin D1/microRNA 17/20 regulatory feedback loop in control of breast cancer cell proliferation. J Cell Biol. 2008 Aug 11;182(3):509-17.
REF 22 MiRNA-20 and mirna-106a regulate spermatogonial stem cell renewal at the post-transcriptional level via targeting STAT3 and Ccnd1. Stem Cells. 2013 Oct;31(10):2205-17.
REF 23 MicroRNA-503 suppresses proliferation and cell-cycle progression of endometrioid endometrial cancer by negatively regulating cyclin D1. FEBS J. 2013 Aug;280(16):3768-79.
REF 24 Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. Leukemia. 2010 Feb;24(2):460-6.
REF 25 Systematic validation of predicted microRNAs for cyclin D1. BMC Cancer. 2009 Jun 18;9:194.
REF 26 MicroRNA let-7b regulates neural stem cell proliferation and differentiation by targeting nuclear receptor TLX signaling. Proc Natl Acad Sci U S A. 2010 Feb 2;107(5):1876-81.
REF 27 Let-7b expression determines response to chemotherapy through the regulation of cyclin D1 in glioblastoma. J Exp Clin Cancer Res. 2013 Jun 27;32:41.
REF 28 MicroRNA-155 expression inversely correlates with pathologic stage of gastric cancer and it inhibits gastric cancer cell growth by targeting cyclin D1. J Cancer Res Clin Oncol. 2016 Jun;142(6):1201-12.
REF 29 MicroRNA-155 inhibits proliferation and migration of human extravillous trophoblast derived HTR-8/SVneo cells via down-regulating cyclin D1. Placenta. 2012 Oct;33(10):824-9.
REF 30 MicroRNA miR-302 inhibits the tumorigenecity of human pluripotent stem cells by coordinate suppression of the CDK2 and CDK4/6 cell cycle pathways. Cancer Res. 2010 Nov 15;70(22):9473-82.
REF 31 Oct4/Sox2-regulated miR-302 targets cyclin D1 in human embryonic stem cells. Mol Cell Biol. 2008 Oct;28(20):6426-38.
REF 32 MicroRNA-365 inhibits vascular smooth muscle cell proliferation through targeting cyclin D1. Int J Med Sci. 2014 May 21;11(8):765-70.
REF 33 Akt-p53-miR-365-cyclin D1/cdc25A axis contributes to gastric tumorigenesis induced by PTEN deficiency. Nat Commun. 2013;4:2544.
REF 34 microRNA-365, down-regulated in colon cancer, inhibits cell cycle progression and promotes apoptosis of colon cancer cells by probably targeting Cyclin D1 and Bcl-2. Carcinogenesis. 2012 Jan;33(1):220-5.
REF 35 Jumonji/ARID1 B (JARID1B) protein promotes breast tumor cell cycle progression through epigenetic repression of microRNA let-7e. J Biol Chem. 2011 Nov 25;286(47):40531-5.
REF 36 Deregulation of let-7e in epithelial ovarian cancer promotes the development of resistance to cisplatin. Oncogenesis. 2013 Oct 7;2:e75.
REF 37 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 38 MiR-15b targets cyclin D1 to regulate proliferation and apoptosis in glioma cells. Biomed Res Int. 2014;2014:687826.
REF 39 MicroRNA-15b regulates cell cycle progression by targeting cyclins in glioma cells. Biochem Biophys Res Commun. 2009 Mar 6;380(2):205-10.
REF 40 MicroRNA-19a mediates the suppressive effect of laminar flow on cyclin D1 expression in human umbilical vein endothelial cells. Proc Natl Acad Sci U S A. 2010 Feb 16;107(7):3240-4.
REF 41 Cyclin D1 is a major target of miR-206 in cell differentiation and transformation. Cell Cycle. 2013 Dec 15;12(24):3781-90.
REF 42 Selective repression of the oncogene cyclin D1 by the tumor suppressor miR-206 in cancers. Oncogenesis. 2014 Aug 11;3:e113.
REF 43 MicroRNA-20b inhibits the proliferation, migration and invasion of bladder cancer EJells via the targeting of cellycle regulation and Sp-1-mediated MMP-2 expression. Oncol Rep. 2015 Sep;34(3):1605-12.
REF 44 miR-338-3p is down-regulated by hepatitis B virus X and inhibits cell proliferation by targeting the 3'-UTR region of CyclinD1. Int J Mol Sci. 2012;13(7):8514-39.
REF 45 The effect of miR-338-3p on HBx deletion-mutant (HBx-d382) mediated liver-cell proliferation through CyclinD1 regulation. PLoS One. 2012;7(8):e43204.
REF 46 miR-340 inhibits glioblastoma cell proliferation by suppressing CDK6, cyclin-D1 and cyclin-D2. Biochem Biophys Res Commun. 2015 May 8;460(3):670-7.
REF 47 microRNA-374a suppresses colon cancer progression by directly reducing CCND1 to inactivate the PI3K/AKT pathway. Oncotarget. 2016 Jul 5;7(27):41306-41319.
REF 48 MicroRNA-383 inhibits anchorage-independent growth and induces cell cycle arrest of glioma cells by targeting CCND1. Biochem Biophys Res Commun. 2014 Oct 31;453(4):833-8.
REF 49 The targeting and functions of miRNA-383 are mediated by FMRP during spermatogenesis. Cell Death Dis. 2013 May 2;4:e617.
REF 50 miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 2008 Sep;36(16):5391-404.
REF 51 Downregulation of specific miRNAs in hyperdiploid multiple myeloma mimics the oncogenic effect of IgH translocations occurring in the non-hyperdiploid subtype. Leukemia. 2013 Apr;27(4):925-31.
REF 52 miR-449a causes Rb-dependent cell cycle arrest and senescence in prostate cancer cells. Oncotarget. 2010 Sep;1(5):349-58.
REF 53 miR-449a Regulates proliferation and chemosensitivity to cisplatin by targeting cyclin D1 and BCL2 in SGC7901 cells. Dig Dis Sci. 2014 Feb;59(2):336-45.
REF 54 The High Mobility Group A proteins contribute to thyroid cell transformation by regulating miR-603 and miR-10b expression. Mol Oncol. 2013 Jun;7(3):531-42.
REF 55 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 56 Overexpression of microRNA-95-3p suppresses brain metastasis of lung adenocarcinoma through downregulation of cyclin D1. Oncotarget. 2015 Aug 21;6(24):20434-48.
REF 57 miR-3940-5p Functions as a Tumor Suppressor in Non-Small Cell Lung Cancer Cells by Targeting Cyclin D1 and Ubiquitin Specific Peptidase-28. Transl Oncol. 2017 Feb;10(1):80-89.
REF 58 MiR-146a-5p inhibits cell proliferation and cell cycle progression in NSCLC cell lines by targeting CCND1 and CCND2. Oncotarget. 2016 Sep 13;7(37):59287-59298.
REF 59 Truncation in CCND1 mRNA alters miR-16-1 regulation in mantle cell lymphoma. Blood. 2008 Aug 1;112(3):822-9.
REF 60 Arm Selection Preference of MicroRNA-193a Varies in Breast Cancer. Sci Rep. 2016 Jun 16;6:28176.
REF 61 MiR-19b-1 inhibits angiogenesis by blocking cell cycle progression of endothelial cells. Biochem Biophys Res Commun. 2012 Jan 13;417(2):771-6.
REF 62 miR-211 suppresses epithelial ovarian cancer proliferation and cell-cycle progression by targeting Cyclin D1 and CDK6. Mol Cancer. 2015 Mar 11;14:57.
REF 63 Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. J Exp Clin Cancer Res. 2011 May 13;30:55.
REF 64 Reduced miR-29a-3p expression is linked to the cell proliferation and cell migration in gastric cancer. World J Surg Oncol. 2015 Mar 12;13:101.
REF 65 Expression of transforming growth factor 1 promotes cholangiocarcinoma development and progression. Cancer Lett. 2016 Sep 28;380(1):153-62.
REF 66 miRNA-34b as a tumor suppressor in estrogen-dependent growth of breast cancer cells. Breast Cancer Res. 2011;13(6):R116.
REF 67 MicroRNA-490-3p inhibits proliferation of A549 lung cancer cells by targeting CCND1. Biochem Biophys Res Commun. 2014 Jan 31;444(1):104-8.
REF 68 Suppressing role of miR-520a-3p in breast cancer through CCND1 and CD44. Am J Transl Res. 2017 Jan 15;9(1):146-154.
REF 69 miR-708 acts as a tumor suppressor in human glioblastoma cells. Oncol Rep. 2013 Aug;30(2):870-6.
REF 70 MicroRNA-892b influences proliferation, migration and invasion of bladder cancer cells by mediating the p19ARF/cyclin D1/CDK6 and Sp-1/MMP-9 pathways. Oncol Rep. 2016 Oct;36(4):2313-20.
REF 71 miR-2861 acts as a tumor suppressor via targeting EGFR/AKT2/CCND1 pathway in cervical cancer induced by human papillomavirus virus 16 E6. Sci Rep. 2016 Jul 1;6:28968.
REF 72 MicroRNA-576-3p inhibits proliferation in bladder cancer cells by targeting cyclin D1. Mol Cells. 2015;38(2):130-7.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.