miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-206
miRNA Stemloop AC MI0000490
miRNA Stemloop ID hsa-mir-206
Sequence uggaauguaaggaagugugugg
TTD Target(s) Regulated by This miRNA Estrogen receptor (ESR) Successful Target Target Info [1]
Cyclin-dependent kinase 4 (CDK4) Successful Target Target Info [2]
Glucose-6-phosphate dehydrogenase (G6PD) Successful Target Target Info [3]
Insulin-like growth factor I receptor (IGF1R) Successful Target Target Info [4]
Proto-oncogene c-Met (MET) Successful Target Target Info [5]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [4]
Phosphogluconate dehydrogenase (PGD) Successful Target Target Info [3]
Neuropilin-1 (NRP1) Successful Target Target Info [6]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [7]
RAC-alpha serine/threonine-protein kinase (AKT1) Successful Target Target Info [8]
Histone deacetylase 4 (HDAC4) Clinical trial Target Target Info [4]
Monocyte chemotactic and activating factor (CCL2) Clinical trial Target Target Info [7]
Superoxide dismutase Cu-Zn (SOD Cu-Zn) Clinical trial Target Target Info [9]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [10]
Utrophin (UTRN) Clinical trial Target Target Info [11]
Brain-derived neurotrophic factor (BDNF) Clinical trial Target Target Info [4]
Gap junction alpha-1 protein (GJA1) Clinical trial Target Target Info [12]
Notch-3 receptor (NOTCH3) Clinical trial Target Target Info [13]
Kruppel like factor 4 (KLF4) Clinical trial Target Target Info [4]
Oxysterols receptor LXR-alpha (NR1H3) Patented-recorded Target Target Info [14]
Transketolase (TK) Literature-reported Target Target Info [3]
Annexin A2 (ANXA2) Literature-reported Target Target Info [15]
Orphan nuclear receptor NURR1 (NR4A2) Literature-reported Target Target Info [16]
Stanniocalcin-2 (STC2) Literature-reported Target Target Info [4]
Protein(s) Regulated by This miRNA Actin-like protein 6A Regulated Protein
ACL6A_HUMAN
[17]
Fibroblast growth factor receptor substrate 2 Regulated Protein
FRS2_HUMAN
[4]
Follistatin-related protein 1 Regulated Protein
FSTL1_HUMAN
[19]
G1/S-specific cyclin-D2 Regulated Protein
CCND2_HUMAN
[20]
Glycerol-3-phosphate dehydrogenase, mitochondrial Regulated Protein
GPDM_HUMAN
[3]
Homeobox protein OTX2 Regulated Protein
OTX2_HUMAN
[22]
Mothers against decapentaplegic homolog 2 Regulated Protein
SMAD2_HUMAN
[6]
Paired box protein Pax-3 Regulated Protein
PAX3_HUMAN
[24]
Protachykinin-1 Regulated Protein
TKN1_HUMAN
[25]
Secreted frizzled-related protein 1 Regulated Protein
SFRP1_HUMAN
[4]
SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily B member 1 Regulated Protein
SNF5_HUMAN
[26]
T-box transcription factor TBX3 Regulated Protein
TBX3_HUMAN
[27]
Transcription factor SOX-9 Regulated Protein
SOX9_HUMAN
[28]
Twinfilin-1 Regulated Protein
TWF1_HUMAN
[29]
Twist-related protein 1 Regulated Protein
TWST1_HUMAN
[30]
Vesicle-associated membrane protein 2 Regulated Protein
VAMP2_HUMAN
[31]
References
REF 1 The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47.
REF 2 MicroRNA-206 induces G1 arrest in melanoma by inhibition of CDK4 and Cyclin D. Pigment Cell Melanoma Res. 2014 Mar;27(2):275-86.
REF 3 Transcription factor NRF2 regulates miR-1 and miR-206 to drive tumorigenesis. J Clin Invest. 2013 Jul;123(7):2921-34.
REF 4 MicroRNA-206 suppresses gastric cancer cell growth and metastasis. Cell Biosci. 2014 May 5;4:26.
REF 5 Down-regulation of micro-RNA-1 (miR-1) in lung cancer. Suppression of tumorigenic property of lung cancer cells and their sensitization to doxorubicin-induced apoptosis by miR-1. J Biol Chem. 2008 Nov 28;283(48):33394-405.
REF 6 MiR-206 suppresses epithelial mesenchymal transition by targeting TGF- signaling in estrogen receptor positive breast cancer cells. Oncotarget. 2016 Apr 26;7(17):24537-48.
REF 7 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 8 Skeletal Muscle myomiR Are Differentially Expressed by Endurance Exercise Mode and Combined Essential Amino Acid and Carbohydrate Supplementation. Front Physiol. 2017 Mar 23;8:182.
REF 9 MicroRNA profiling of atrial fibrillation in canines: miR-206 modulates intrinsic cardiac autonomic nerve remodeling by regulating SOD1. PLoS One. 2015 Mar 27;10(3):e0122674.
REF 10 Cyclin D1 is a major target of miR-206 in cell differentiation and transformation. Cell Cycle. 2013 Dec 15;12(24):3781-90.
REF 11 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
REF 12 MIR-206 regulates connexin43 expression during skeletal muscle development. Nucleic Acids Res. 2006;34(20):5863-71.
REF 13 MicroRNA-206 targets notch3, activates apoptosis, and inhibits tumor cell migration and focus formation. J Biol Chem. 2009 Nov 13;284(46):31921-7.
REF 14 miR-206 controls LXR expression and promotes LXR-mediated cholesterol efflux in macrophages. Biochim Biophys Acta. 2014 Jun;1841(6):827-35.
REF 15 MicroRNA-206 functions as a pleiotropic modulator of cell proliferation, invasion and lymphangiogenesis in pancreatic adenocarcinoma by targeting ANXA2 and KRAS genes. Oncogene. 2015 Sep 10;34(37):4867-78.
REF 16 miR-206 modulates lipopolysaccharide-mediated inflammatory cytokine production in human astrocytes. Cell Signal. 2015 Jan;27(1):61-8.
REF 17 Failure to downregulate the BAF53a subunit of the SWI/SNF chromatin remodeling complex contributes to the differentiation block in rhabdomyosarcoma.Oncogene. 2014 May 1;33(18):2354-62.
REF 18 MicroRNA-206 suppresses gastric cancer cell growth and metastasis. Cell Biosci. 2014 May 5;4:26.
REF 19 MyoD inhibits Fstl1 and Utrn expression by inducing transcription of miR-206. J Cell Biol. 2006 Oct 9;175(1):77-85.
REF 20 miR-206 inhibits gastric cancer proliferation in part by repressing cyclinD2.Cancer Lett. 2013 May 10;332(1):94-101.
REF 21 Transcription factor NRF2 regulates miR-1 and miR-206 to drive tumorigenesis. J Clin Invest. 2013 Jul;123(7):2921-34.
REF 22 MiR-206, a Cerebellum Enriched miRNA Is Downregulated in All Medulloblastoma Subgroups and Its Overexpression Is Necessary for Growth Inhibition of Medulloblastoma Cells.J Mol Neurosci. 2015 Jul;56(3):673-80.
REF 23 MiR-206 suppresses epithelial mesenchymal transition by targeting TGF- signaling in estrogen receptor positive breast cancer cells. Oncotarget. 2016 Apr 26;7(17):24537-48.
REF 24 MyoD regulates apoptosis of myoblasts through microRNA-mediated down-regulation of Pax3.J Cell Biol. 2010 Oct 18;191(2):347-65.
REF 25 MicroRNAs regulate synthesis of the neurotransmitter substance P in human mesenchymal stem cell-derived neuronal cells.Proc Natl Acad Sci U S A. 2007 Sep 25;104(39):15484-9.
REF 26 SMARCB1 expression in epithelioid sarcoma is regulated by miR-206, miR-381, and miR-671-5p on Both mRNA and protein levels.Genes Chromosomes Cancer. 2014 Feb;53(2):168-76.
REF 27 Regulation of the T-box transcription factor Tbx3 by the tumour suppressor microRNA-206 in breast cancer.Br J Cancer. 2016 May 10;114(10):1125-34.
REF 28 miR-206 inhibits non small cell lung cancer cell proliferation and invasion by targeting SOX9. Int J Clin Exp Med. 2015 Jun 15;8(6):9107-13.
REF 29 miR-206 Inhibits Stemness and Metastasis of Breast Cancer by Targeting MKL1/IL11 Pathway.Clin Cancer Res. 2017 Feb 15;23(4):1091-1103.
REF 30 MyoD transcription factor induces myogenesis by inhibiting Twist-1 through miR-206.J Cell Sci. 2015 Oct 1;128(19):3631-45.
REF 31 MicroRNA-206 regulates surfactant secretion by targeting VAMP-2.FEBS Lett. 2015 Jan 2;589(1):172-6.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.