miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-490-3p | ||||
| miRNA Stemloop AC | MI0003125 | ||||
| miRNA Stemloop ID | hsa-mir-490 | ||||
| Sequence | caaccuggaggacuccaugcug | ||||
| TTD Target(s) Regulated by This miRNA | TGF-beta receptor type I (TGFBR1) | Clinical trial Target | Target Info | [1] | |
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [2] | ||
| Transforming growth factor alpha (TGFA) | Clinical trial Target | Target Info | [3] | ||
| Tankyrase-2 (TNKS-2) | Clinical trial Target | Target Info | [4] | ||
| Transforming protein RhoA (RHOA) | Discontinued Target | Target Info | [5] | ||
| Multidrug resistance-associated protein 2 (ABCC2) | Literature-reported Target | Target Info | [6] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | Endoplasmic reticulum-Golgi intermediate compartment protein 3 | Regulated Protein | [8] | ||
| Pappalysin-1 | Regulated Protein | [9] | |||
| Poly(rC)-binding protein 1 | Regulated Protein | [10] | |||
| SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily D member 1 | Regulated Protein | [11] | |||
| References | |||||
| REF 1 | MicroRNA-490-3p inhibits colorectal cancer metastasis by targeting TGFR1. BMC Cancer. 2015 Dec 29;15:1023. | ||||
| REF 2 | MicroRNA-490-3p inhibits proliferation of A549 lung cancer cells by targeting CCND1. Biochem Biophys Res Commun. 2014 Jan 31;444(1):104-8. | ||||
| REF 3 | The correlation between microRNA490-3p and TGF in endometrial carcinoma tumorigenesis and progression. Oncotarget. 2016 Feb 23;7(8):9236-49. | ||||
| REF 4 | miR-490-3p inhibits the growth and invasiveness in triple-negative breast cancer by repressing the expression of TNKS2. Gene. 2016 Nov 15;593(1):41-47. | ||||
| REF 5 | MicroRNA-490 inhibits tumorigenesis and progression in breast cancer. Onco Targets Ther. 2016 Jul 22;9:4505-16. | ||||
| REF 6 | MiR-490-3p sensitizes ovarian cancer cells to cisplatin by directly targeting ABCC2. Am J Transl Res. 2017 Mar 15;9(3):1127-1138. | ||||
| REF 7 | MicroRNA-490-3p regulates cell proliferation and apoptosis by targeting HMGA2 in osteosarcoma. FEBS Lett. 2015 Oct 7;589(20 Pt B):3148-53. | ||||
| REF 8 | miR-490-3p modulates cell growth and epithelial to mesenchymal transition of hepatocellular carcinoma cells by targeting endoplasmic reticulum-Golgi intermediate compartment protein 3 (ERGIC3).J Biol Chem. 2013 Feb 8;288(6):4035-47. | ||||
| REF 9 | MiR-490-3p modulates the proliferation of vascular smooth muscle cells induced by ox-LDL through targeting PAPP-A.Cardiovasc Res. 2013 Nov 1;100(2):272-9. | ||||
| REF 10 | Poly r(C) binding protein (PCBP) 1 is a negative regulator of thyroid carcinoma. Am J Transl Res. 2016 Aug 15;8(8):3567-73. | ||||
| REF 11 | Epigenetic silencing of miR-490-3p reactivates the chromatin remodeler SMARCD1 to promote Helicobacter pylori-induced gastric carcinogenesis.Cancer Res. 2015 Feb 15;75(4):754-65. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.