miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-193b-3p | ||||
| miRNA Stemloop AC | MI0003137 | ||||
| miRNA Stemloop ID | hsa-mir-193b | ||||
| Sequence | aacuggcccucaaagucccgcu | ||||
| TTD Target(s) Regulated by This miRNA | Estrogen receptor (ESR) | Successful Target | Target Info | [1] | |
| Tyrosine-protein kinase Kit (KIT) | Successful Target | Target Info | [2] | ||
| Urokinase-type plasminogen activator (PLAU) | Successful Target | Target Info | [3] | ||
| Induced myeloid leukemia cell differentiation protein Mcl-1 (MCL1) | Clinical trial Target | Target Info | [4] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [5] | ||
| DNA repair protein RAD51 homolog 1 (RAD51) | Clinical trial Target | Target Info | [5] | ||
| Protein C-ets-1 (ETS1) | Literature-reported Target | Target Info | [6] | ||
| Mothers against decapentaplegic homolog 3 (SMAD3) | Preclinical Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | 14-3-3 protein zeta/delta | Regulated Protein | [8] | ||
| Aldo-keto reductase family 1 member C2 | Regulated Protein | [8] | |||
| Neurofibromin | Regulated Protein | [9] | |||
| Proline-rich acidic protein 1 | Regulated Protein | [10] | |||
| Protein max | Regulated Protein | [11] | |||
| Serine hydroxymethyltransferase, mitochondrial | Regulated Protein | [8] | |||
| References | |||||
| REF 1 | The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47. | ||||
| REF 2 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
| REF 3 | MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells. FEBS J. 2009 Jun;276(11):2966-82. | ||||
| REF 4 | Hepatitis C virus proteins modulate microRNA expression and chemosensitivity in malignant hepatocytes. Clin Cancer Res. 2010 Feb 1;16(3):957-66. | ||||
| REF 5 | MicroRNA-193b represses cell proliferation and regulates cyclin D1 in melanoma. Am J Pathol. 2010 May;176(5):2520-9. | ||||
| REF 6 | MicroRNA-193b regulates proliferation, migration and invasion in human hepatocellular carcinoma cells. Eur J Cancer. 2010 Oct;46(15):2828-36. | ||||
| REF 7 | miR-193b promotes cell proliferation by targeting Smad3 in human glioma. J Neurosci Res. 2014 May;92(5):619-26. | ||||
| REF 8 | Identification of miR-193b targets in breast cancer cells and systems biological analysis of their functional impact.Mol Cell Proteomics. 2011 Jul;10(7):M110.005322. | ||||
| REF 9 | MicroRNA-193b enhances tumor progression via down regulation of neurofibromin 1.PLoS One. 2013;8(1):e53765. | ||||
| REF 10 | Impaired MicroRNA Processing Facilitates Breast Cancer Cell Invasion by Upregulating Urokinase-Type Plasminogen Activator Expression.Genes Cancer. 2011 Feb;2(2):140-50. | ||||
| REF 11 | miR-193b/365a cluster controls progression of epidermal squamous cell carcinoma.Carcinogenesis. 2014 May;35(5):1110-20. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.