miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-95-3p | ||||
| miRNA Stemloop AC | MI0000097 | ||||
| miRNA Stemloop ID | hsa-mir-95 | ||||
| Sequence | uucaacggguauuuauugagca | ||||
| TTD Target(s) Regulated by This miRNA | G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [1] | |
| Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | CCAAT/enhancer-binding protein delta | Regulated Protein | [3] | ||
| CUGBP Elav-like family member 2 | Regulated Protein | [4] | |||
| Sorting nexin-1 | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 2 | Up-regulation of miR-95-3p in hepatocellular carcinoma promotes tumorigenesis by targeting p21 expression. Sci Rep. 2016 Oct 4;6:34034. | ||||
| REF 3 | Downregulation of miR-95-3p inhibits proliferation, and invasion promoting apoptosis of glioma cells by targeting CELF2.Int J Oncol. 2015 Sep;47(3):1025-33. | ||||
| REF 4 | Role of microRNA-95 in the anticancer activity of Brucein D in hepatocellular carcinoma.Eur J Pharmacol. 2014 Apr 5;728:141-50. | ||||
| REF 5 | MicroRNA-95 promotes cell proliferation and targets sorting Nexin 1 in human colorectal carcinoma.Cancer Res. 2011 Apr 1;71(7):2582-9. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.