miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-let-7e-5p | ||||
| miRNA Stemloop AC | MI0000066 | ||||
| miRNA Stemloop ID | hsa-let-7e | ||||
| Sequence | ugagguaggagguuguauaguu | ||||
| TTD Target(s) Regulated by This miRNA | Insulin-like growth factor I receptor (IGF1R) | Successful Target | Target Info | [1] | |
| Thrombopoietin receptor (MPL) | Successful Target | Target Info | [2] | ||
| Matrix metalloproteinase-9 (MMP-9) | Clinical trial Target | Target Info | [3] | ||
| Aurora kinase B (AURKB) | Clinical trial Target | Target Info | [4] | ||
| Polo-like kinase 1 (PLK1) | Clinical trial Target | Target Info | [5] | ||
| Enhancer of zeste homolog 2 (EZH2) | Successful Target | Target Info | [6] | ||
| TRAIL receptor 2 (TRAIL-R2) | Clinical trial Target | Target Info | [7] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [8] | ||
| Insulin-like growth factor-I (IGF1) | Clinical trial Target | Target Info | [9] | ||
| Zinc finger protein A20 (TNFAIP3) | Literature-reported Target | Target Info | [10] | ||
| Apoptosis antigen ligand (CD178) | Literature-reported Target | Target Info | [11] | ||
| N-myc proto-oncogene protein (MYCN) | Literature-reported Target | Target Info | [12] | ||
| High mobility group protein HMGI-C (HMGA2) | Literature-reported Target | Target Info | [13] | ||
| Protein(s) Regulated by This miRNA | AT-rich interactive domain-containing protein 3A | Regulated Protein | [14] | ||
| Eukaryotic translation initiation factor 3 subunit J | Regulated Protein | [15] | |||
| Protein argonaute-1 | Regulated Protein | [16] | |||
| Protein lin-28 homolog A | Regulated Protein | [4] | |||
| Proto-oncogene Wnt-1 | Regulated Protein | [18] | |||
| Structural maintenance of chromosomes protein 1A | Regulated Protein | [15] | |||
| References | |||||
| REF 1 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
| REF 2 | miR-28 is a thrombopoietin receptor targeting microRNA detected in a fraction of myeloproliferative neoplasm patient platelets. Blood. 2010 Jul 22;116(3):437-45. | ||||
| REF 3 | miRNA let-7e targeting MMP9 is involved in adipose-derived stem cell differentiation toward epithelia. Cell Death Dis. 2014 Feb 6;5:e1048. | ||||
| REF 4 | LIN28 Expression in malignant germ cell tumors downregulates let-7 and increases oncogene levels. Cancer Res. 2013 Aug 1;73(15):4872-84. | ||||
| REF 5 | Identification of post-transcriptional regulatory networks during myeloblast-to-monocyte differentiation transition. RNA Biol. 2015;12(7):690-700. | ||||
| REF 6 | Deregulation of let-7e in epithelial ovarian cancer promotes the development of resistance to cisplatin. Oncogenesis. 2013 Oct 7;2:e75. | ||||
| REF 7 | Nuclear death receptor TRAIL-R2 inhibits maturation of let-7 and promotes proliferation of pancreatic and other tumor cells. Gastroenterology. 2014 Jan;146(1):278-90. | ||||
| REF 8 | Jumonji/ARID1 B (JARID1B) protein promotes breast tumor cell cycle progression through epigenetic repression of microRNA let-7e. J Biol Chem. 2011 Nov 25;286(47):40531-5. | ||||
| REF 9 | Upstream and downstream mechanisms for the promoting effects of IGF-1 on differentiation of spermatogonia to primary spermatocytes. Life Sci. 2014 Apr 17;101(1-2):49-55. | ||||
| REF 10 | Let-7 miRNAs Modulate the Activation of NF-B by Targeting TNFAIP3 and Are Involved in the Pathogenesis of Lupus Nephritis. PLoS One. 2015 Jun 25;10(6):e0121256. | ||||
| REF 11 | Downregulation of let-7e-5p contributes to endothelial progenitor cell dysfunction in deep vein thrombosis via targeting FASLG. Thromb Res. 2016 Feb;138:30-36. | ||||
| REF 12 | Tumour-suppressor microRNAs let-7 and mir-101 target the proto-oncogene MYCN and inhibit cell proliferation in MYCN-amplified neuroblastoma. Br J Cancer. 2011 Jul 12;105(2):296-303. | ||||
| REF 13 | High mobility group A2 is a target for miRNA-98 in head and neck squamous cell carcinoma. Mol Cancer. 2007 Jan 14;6:5. | ||||
| REF 14 | ZEB1 induced miR-99b/let-7e/miR-125a cluster promotes invasion and metastasis in esophageal squamous cell carcinoma.Cancer Lett. 2017 Jul 10;398:37-45. | ||||
| REF 15 | A combined computational-experimental approach predicts human microRNA targets. Genes Dev. 2004 May 15;18(10):1165-78. | ||||
| REF 16 | Hypoxia-responsive miRNAs target argonaute 1 to promote angiogenesis.J Clin Invest. 2013 Mar;123(3):1057-67. | ||||
| REF 17 | LIN28 Expression in malignant germ cell tumors downregulates let-7 and increases oncogene levels. Cancer Res. 2013 Aug 1;73(15):4872-84. | ||||
| REF 18 | MicroRNA profiling identifies miR-34a and miR-21 and their target genes JAG1 and WNT1 in the coordinate regulation of dendritic cell differentiation.Blood. 2009 Jul 9;114(2):404-14. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.