miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-603 | ||||
| miRNA Stemloop AC | MI0003616 | ||||
| miRNA Stemloop ID | hsa-mir-603 | ||||
| Sequence | cacacacugcaauuacuuuugc | ||||
| TTD Target(s) Regulated by This miRNA | G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [1] | |
| Insulin-like growth factor-I (IGF1) | Clinical trial Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Eukaryotic elongation factor 2 kinase | Regulated Protein | [3] | ||
| G1/S-specific cyclin-D2 | Regulated Protein | [4] | |||
| Trafficking protein particle complex subunit 2B | Regulated Protein | [5] | |||
| References | |||||
| REF 1 | A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64. | ||||
| REF 2 | The Functional Variant in the 3'UTR of IGF1 with the Risk of Gastric Cancer in a Chinese Population. Cell Physiol Biochem. 2015;36(3):884-92. | ||||
| REF 3 | MicroRNA 603 acts as a tumor suppressor and inhibits triple-negative breast cancer tumorigenesis by targeting elongation factor 2 kinase.Oncotarget. 2017 Feb 14;8(7):11641-11658. | ||||
| REF 4 | The High Mobility Group A proteins contribute to thyroid cell transformation by regulating miR-603 and miR-10b expression. Mol Oncol. 2013 Jun;7(3):531-42. | ||||
| REF 5 | MicroRNAs are differentially expressed in ulcerative colitis and alter expression of macrophage inflammatory peptide-2 alpha.Gastroenterology. 2008 Nov;135(5):1624-1635.e24. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.