miRNA Details

miRNA General Information
miRNA Mature ID hsa-miR-15a-5p
miRNA Stemloop AC MI0000069
miRNA Stemloop ID hsa-mir-15a
Sequence uagcagcacauaaugguuugug
TTD Target(s) Regulated by This miRNA Proto-oncogene c-Ret (RET) Successful Target Target Info [1]
Amyloid beta A4 protein (APP) Successful Target Target Info [2]
Apoptosis regulator Bcl-2 (BCL-2) Successful Target Target Info [3]
Interferon-gamma (IFNG) Successful Target Target Info [4]
Vascular endothelial growth factor A (VEGFA) Successful Target Target Info [5]
Checkpoint kinase-1 (CHK1) Clinical trial Target Target Info [6]
RAC-gamma serine/threonine-protein kinase (AKT3) Successful Target Target Info [7]
Wee1-like protein kinase (WEE1) Clinical trial Target Target Info [8]
Cellular tumor antigen p53 (TP53) Clinical trial Target Target Info [9]
Beta-secretase 1 (BACE1) Clinical trial Target Target Info [10]
C-X-C motif chemokine 10 (CXCL10) Clinical trial Target Target Info [11]
G1/S-specific cyclin-D1 (CCND1) Clinical trial Target Target Info [12]
Wilms tumor protein (WT1) Clinical trial Target Target Info [13]
Brain-derived neurotrophic factor (BDNF) Clinical trial Target Target Info [14]
DNA-binding factor KBF1 (p105) Clinical trial Target Target Info [15]
Mitochondrial uncoupling protein 2 (UCP2) Clinical trial Target Target Info [16]
Keratinocyte growth factor (FGF7) Clinical trial Target Target Info [17]
Kruppel like factor 4 (KLF4) Clinical trial Target Target Info [18]
Protein delta homolog 1 (DLK1) Clinical trial Target Target Info [19]
M-phase inducer phosphatase 1 (MPIP1) Literature-reported Target Target Info [20]
Inhibitor of nuclear factor kappa-B kinase alpha (IKKA) Literature-reported Target Target Info [21]
G1/S-specific cyclin-E1 (CCNE1) Literature-reported Target Target Info [22]
Histone-arginine methyltransferase CARM1 (CARM1) Literature-reported Target Target Info [23]
Forkhead box protein O1A (FOXO1) Literature-reported Target Target Info [24]
Polycomb complex protein BMI-1 (BMI1) Clinical trial Target Target Info [25]
Chloride channel protein 3 (CLC-3) Literature-reported Target Target Info [26]
High mobility group protein HMG-I/Y (HMGA1) Literature-reported Target Target Info [27]
Yes-associated protein 1 (YAP1) Literature-reported Target Target Info [28]
High mobility group protein HMGI-C (HMGA2) Literature-reported Target Target Info [27]
Suppressor of tumorigenicity 15 protein (ST15) Literature-reported Target Target Info [7]
Transcription factor SOX-5 (SOX5) Literature-reported Target Target Info [29]
Protein(s) Regulated by This miRNA Breast cancer type 1 susceptibility protein Regulated Protein
BRCA1_HUMAN
[30]
BTB/POZ domain-containing adapter for CUL3-mediated RhoA degradation protein 2 Regulated Protein
BACD2_HUMAN
[31]
Cell adhesion molecule 1 Regulated Protein
CADM1_HUMAN
[13]
Crk-like protein Regulated Protein
CRKL_HUMAN
[26]
Cyclin-D-binding Myb-like transcription factor 1 Regulated Protein
DMTF1_HUMAN
[34]
Cyclin-dependent kinase 4 inhibitor B Regulated Protein
CDN2B_HUMAN
[35]
G1/S-specific cyclin-D2 Regulated Protein
CCND2_HUMAN
[36]
Heat shock 70 kDa protein 1B Regulated Protein
HS71B_HUMAN
[37]
Interleukin-10 receptor subunit alpha Regulated Protein
I10R1_HUMAN
[38]
Krueppel-like factor 6 Regulated Protein
KLF6_HUMAN
[39]
PH domain leucine-rich repeat-containing protein phosphatase 1 Regulated Protein
PHLP1_HUMAN
[40]
Programmed cell death protein 4 Regulated Protein
PDCD4_HUMAN
[13]
Protein Wnt-3a Regulated Protein
WNT3A_HUMAN
[41]
Ras-related protein Rab-21 Regulated Protein
RAB21_HUMAN
[13]
Replication initiator 1 Regulated Protein
REPI1_HUMAN
[42]
Src kinase-associated phosphoprotein 2 Regulated Protein
SKAP2_HUMAN
[13]
Testis-specific Y-encoded-like protein 2 Regulated Protein
TSYL2_HUMAN
[43]
Transcriptional activator MN1 Regulated Protein
MN1_HUMAN
[26]
Transcriptional activator protein Pur-alpha Regulated Protein
PURA_HUMAN
[44]
Transmembrane protein 184B Regulated Protein
T184B_HUMAN
[34]
References
REF 1 Acute myeloid leukemia with translocation (8;16)(p11;p13) and MYST3-CREBBP rearrangement harbors a distinctive microRNA signature targeting RET proto-oncogene. Leukemia. 2013 Mar;27(3):595-603.
REF 2 MicroRNA regulation of Alzheimer's Amyloid precursor protein expression. Neurobiol Dis. 2009 Mar;33(3):422-8.
REF 3 miR-15 and miR-16 induce apoptosis by targeting BCL2. Proc Natl Acad Sci U S A. 2005 Sep 27;102(39):13944-9.
REF 4 MicroRNA-deficient NK cells exhibit decreased survival but enhanced function. J Immunol. 2012 Apr 1;188(7):3019-30.
REF 5 The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719.
REF 6 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 7 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 8 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 9 Remodeling of Ago2-mRNA interactions upon cellular stress reflects miRNA complementarity and correlates with altered translation rates. Genes Dev. 2013 Jul 15;27(14):1624-32.
REF 10 Loss of microRNA cluster miR-29a/b-1 in sporadic Alzheimer's disease correlates with increased BACE1/beta-secretase expression. Proc Natl Acad Sci U S A. 2008 Apr 29;105(17):6415-20.
REF 11 MiR-15a contributes abnormal immune response in myasthenia gravis by targeting CXCL10. Clin Immunol. 2016 Mar;164:106-13.
REF 12 MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57.
REF 13 MiR-15a and miR-16-1 cluster functions in human leukemia. Proc Natl Acad Sci U S A. 2008 Apr 1;105(13):5166-71.
REF 14 MicroRNA-15a-5p suppresses cancer proliferation and division in human hepatocellular carcinoma by targeting BDNF. Tumour Biol. 2016 May;37(5):5821-8.
REF 15 MicroRNA gene expression during retinoic acid-induced differentiation of human acute promyelocytic leukemia. Oncogene. 2007 Jun 14;26(28):4148-57.
REF 16 MicroRNA-15a positively regulates insulin synthesis by inhibiting uncoupling protein-2 expression. Diabetes Res Clin Pract. 2011 Jan;91(1):94-100.
REF 17 Dysregulation of miR-15a and miR-214 in human pancreatic cancer. J Hematol Oncol. 2010 Nov 24;3:46.
REF 18 Key role of microRNA-15a in the KLF4 suppressions of proliferation and angiogenesis in endothelial and vascular smooth muscle cells. Biochem Biophys Res Commun. 2013 Aug 9;437(4):625-31.
REF 19 MicroRNA-15a fine-tunes the level of Delta-like 1 homolog (DLK1) in proliferating 3T3-L1 preadipocytes. Exp Cell Res. 2010 Jun 10;316(10):1681-91.
REF 20 MicroRNA15a modulates expression of the cell-cycle regulator Cdc25A and affects hepatic cystogenesis in a rat model of polycystic kidney disease. J Clin Invest. 2008 Nov;118(11):3714-24.
REF 21 MicroRNAs modulate the noncanonical transcription factor NF-kappaB pathway by regulating expression of the kinase IKKalpha during macrophage differentiation. Nat Immunol. 2010 Sep;11(9):799-805.
REF 22 A feed-forward loop involving protein kinase Calpha and microRNAs regulates tumor cell cycle. Cancer Res. 2009 Jan 1;69(1):65-74.
REF 23 Coactivator-associated arginine methyltransferase 1 targeted by miR-15a regulates inflammation in acute coronary syndrome. Atherosclerosis. 2014 Apr;233(2):349-56.
REF 24 MiR-15a/b promote adipogenesis in porcine pre-adipocyte via repressing FoxO1. Acta Biochim Biophys Sin (Shanghai). 2014 Jul;46(7):565-71.
REF 25 Targeting of the Bmi-1 oncogene/stem cell renewal factor by microRNA-128 inhibits glioma proliferation and self-renewal. Cancer Res. 2008 Nov 15;68(22):9125-30.
REF 26 Integrative nucleophosmin mutation-associated microRNA and gene expression pattern analysis identifies novel microRNA - target gene interactions in acute myeloid leukemia. Haematologica. 2011 Dec;96(12):1783-91.
REF 27 Downregulation of HMGA-targeting microRNAs has a critical role in human pituitary tumorigenesis. Oncogene. 2012 Aug 23;31(34):3857-65.
REF 28 Targeting of YAP1 by microRNA-15a and microRNA-16-1 exerts tumor suppressor function in gastric adenocarcinoma. Mol Cancer. 2015 Feb 22;14:52.
REF 29 Krpel-like factor 9 inhibits glioma cell proliferation and tumorigenicity via downregulation of miR-21. Cancer Lett. 2015 Jan 28;356(2 Pt B):547-55.
REF 30 Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas.J Virol. 2009 Apr;83(7):3333-41.
REF 31 MiRNA-15a inhibits proliferation, migration and invasion by targeting TNFAIP1 in human osteosarcoma cells. Int J Clin Exp Pathol. 2015 Jun 1;8(6):6442-9.
REF 32 MiR-15a and miR-16-1 cluster functions in human leukemia. Proc Natl Acad Sci U S A. 2008 Apr 1;105(13):5166-71.
REF 33 Integrative nucleophosmin mutation-associated microRNA and gene expression pattern analysis identifies novel microRNA - target gene interactions in acute myeloid leukemia. Haematologica. 2011 Dec;96(12):1783-91.
REF 34 A combined computational-experimental approach predicts human microRNA targets. Genes Dev. 2004 May 15;18(10):1165-78.
REF 35 Upregulation of MicroRNA-15a Contributes to Pathogenesis of Abdominal Aortic Aneurysm (AAA) by Modulating the Expression of Cyclin-Dependent Kinase Inhibitor 2B (CDKN2B).Med Sci Monit. 2017 Feb 18;23:881-888.
REF 36 miR-15a and miR-16 are implicated in cell cycle regulation in a Rb-dependent manner and are frequently deleted or down-regulated in non-small cell lung cancer. Cancer Res. 2009 Jul 1;69(13):5553-9.
REF 37 Expressions of miR-15a and its target gene HSPA1B in the spermatozoa of patients with varicocele.Reproduction. 2014 Apr 8;147(5):693-701.
REF 38 IL-10R expression is post-transcriptionally regulated by miR-15a, miR-185, and miR-211 in melanoma.BMC Med Genomics. 2015 Dec 3;8:81.
REF 39 Vitamin D manipulates miR-181c, miR-20b and miR-15a in human umbilical vein endothelial cells exposed to a diabetic-like environment.Cardiovasc Diabetol. 2014 Jan 7;13:8.
REF 40 Comparative microRNA profiling of prostate carcinomas with increasing tumor stage by deep sequencing.Mol Cancer Res. 2014 Feb;12(2):250-63.
REF 41 The miR-15a-miR-16-1 cluster controls prostate cancer by targeting multiple oncogenic activities. Nat Med. 2008 Nov;14(11):1271-7.
REF 42 p53-induced miR-15a/16-1 and AP4 form a double-negative feedback loop to regulate epithelial-mesenchymal transition and metastasis in colorectal cancer.Cancer Res. 2014 Jan 15;74(2):532-42.
REF 43 Transcriptome-wide prediction of miRNA targets in human and mouse using FASTH. PLoS One. 2009 May 29;4(5):e5745.
REF 44 Translation of Pur- is targeted by cellular miRNAs to modulate the differentiation-dependent susceptibility of monocytes to HIV-1 infection.FASEB J. 2012 Nov;26(11):4755-64.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.