miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-424-5p | ||||
| miRNA Stemloop AC | MI0001446 | ||||
| miRNA Stemloop ID | hsa-mir-424 | ||||
| Sequence | cagcagcaauucauguuuugaa | ||||
| TTD Target(s) Regulated by This miRNA | Fibroblast growth factor receptor 1 (FGFR1) | Successful Target | Target Info | [1] | |
| Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [2] | ||
| Fatty acid synthase (FASN) | Successful Target | Target Info | [3] | ||
| Fibroblast growth factor-2 (FGF2) | Successful Target | Target Info | [4] | ||
| ERK activator kinase 1 (MEK1) | Clinical trial Target | Target Info | [1] | ||
| Checkpoint kinase-1 (CHK1) | Clinical trial Target | Target Info | [5] | ||
| Wee1-like protein kinase (WEE1) | Clinical trial Target | Target Info | [5] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [5] | ||
| Hypoxia-inducible factor 1 alpha (HIF-1A) | Clinical trial Target | Target Info | [6] | ||
| M-phase inducer phosphatase 1 (MPIP1) | Literature-reported Target | Target Info | [5] | ||
| G1/S-specific cyclin-E1 (CCNE1) | Literature-reported Target | Target Info | [5] | ||
| Lysine-specific demethylase 5B (KDM5B) | Literature-reported Target | Target Info | [7] | ||
| Cyclin D (CCND3) | Literature-reported Target | Target Info | [8] | ||
| IP3 receptor isoform 1 (ITPR1) | Literature-reported Target | Target Info | [1] | ||
| Mothers against decapentaplegic homolog 3 (SMAD3) | Preclinical Target | Target Info | [9] | ||
| Protein(s) Regulated by This miRNA | Anillin | Regulated Protein | [5] | ||
| Cullin-2 | Regulated Protein | [6] | |||
| Cyclic AMP-dependent transcription factor ATF-6 alpha | Regulated Protein | [5] | |||
| Cyclin-F | Regulated Protein | [5] | |||
| Dual specificity protein phosphatase CDC14A | Regulated Protein | [5] | |||
| E3 SUMO-protein ligase PIAS1 | Regulated Protein | [1] | |||
| E3 ubiquitin-protein ligase SIAH1 | Regulated Protein | [13] | |||
| Homeobox protein CDX-2 | Regulated Protein | [14] | |||
| Kinesin-like protein KIF23 | Regulated Protein | [5] | |||
| Nuclear factor 1 A-type | Regulated Protein | [15] | |||
| Protein patched homolog 1 | Regulated Protein | [16] | |||
| Suppressor of cytokine signaling 2 | Regulated Protein | [17] | |||
| Suppressor of cytokine signaling 6 | Regulated Protein | [18] | |||
| Transcription factor PU.1 | Regulated Protein | [6] | |||
| Transforming growth factor beta receptor type 3 | Regulated Protein | [19] | |||
| Zinc finger protein PLAG1 | Regulated Protein | [20] | |||
| References | |||||
| REF 1 | MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9. | ||||
| REF 2 | In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193. | ||||
| REF 3 | Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41. | ||||
| REF 4 | An endothelial apelin-FGF link mediated by miR-424 and miR-503 is disrupted in pulmonary arterial hypertension. Nat Med. 2013 Jan;19(1):74-82. | ||||
| REF 5 | Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. Leukemia. 2010 Feb;24(2):460-6. | ||||
| REF 6 | Hypoxia-induced microRNA-424 expression in human endothelial cells regulates HIF- isoforms and promotes angiogenesis. J Clin Invest. 2010 Nov;120(11):4141-54. | ||||
| REF 7 | miR424-5p functions as an anti-oncogene in cervical cancer cell growth by targeting KDM5B via the Notch signaling pathway. Life Sci. 2017 Feb 15;171:9-15. | ||||
| REF 8 | miR-16 family induces cell cycle arrest by regulating multiple cell cycle genes. Nucleic Acids Res. 2008 Sep;36(16):5391-404. | ||||
| REF 9 | miR-424-5p promotes proliferation of gastric cancer by targeting Smad3 through TGF- signaling pathway. Oncotarget. 2016 Nov 15;7(46):75185-75196. | ||||
| REF 10 | Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. Leukemia. 2010 Feb;24(2):460-6. | ||||
| REF 11 | Hypoxia-induced microRNA-424 expression in human endothelial cells regulates HIF- isoforms and promotes angiogenesis. J Clin Invest. 2010 Nov;120(11):4141-54. | ||||
| REF 12 | MiR-205 silences MED1 in hypoxic primary human trophoblasts. FASEB J. 2010 Jun;24(6):2030-9. | ||||
| REF 13 | microRNA profiling in Epstein-Barr virus-associated B-cell lymphoma.Nucleic Acids Res. 2011 Mar;39(5):1880-93. | ||||
| REF 14 | MiR-424 regulates monocytic differentiation of human leukemia U937 cells by directly targeting CDX2.Biotechnol Lett. 2013 Nov;35(11):1799-806. | ||||
| REF 15 | The interplay between the master transcription factor PU.1 and miR-424 regulates human monocyte/macrophage differentiation.Proc Natl Acad Sci U S A. 2007 Dec 11;104(50):19849-54. | ||||
| REF 16 | Hypoxia-induced miR-424 decreases tumor sensitivity to chemotherapy by inhibiting apoptosis.Cell Death Dis. 2014 Jun 26;5:e1301. | ||||
| REF 17 | IL-8 induces miR-424-5p expression and modulates SOCS2/STAT5 signaling pathway in oral squamous cell carcinoma.Mol Oncol. 2016 Jun;10(6):895-909. | ||||
| REF 18 | MicroRNA-424-5p suppresses the expression of SOCS6 in pancreatic cancer.Pathol Oncol Res. 2013 Oct;19(4):739-48. | ||||
| REF 19 | TWIST1-Induced miR-424 Reversibly Drives Mesenchymal Programming while Inhibiting Tumor Initiation.Cancer Res. 2015 May 1;75(9):1908-21. | ||||
| REF 20 | miRNA deregulation by epigenetic silencing disrupts suppression of the oncogene PLAG1 in chronic lymphocytic leukemia.Blood. 2009 Oct 8;114(15):3255-64. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.