miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-302c-3p | ||||
| miRNA Stemloop AC | MI0000773 | ||||
| miRNA Stemloop ID | hsa-mir-302c | ||||
| Sequence | uaagugcuuccauguuucagugg | ||||
| TTD Target(s) Regulated by This miRNA | Estrogen receptor (ESR) | Successful Target | Target Info | [1] | |
| Interleukin-8 (IL8) | Successful Target | Target Info | [2] | ||
| RAC-alpha serine/threonine-protein kinase (AKT1) | Successful Target | Target Info | [3] | ||
| G1/S-specific cyclin-D1 (CCND1) | Clinical trial Target | Target Info | [4] | ||
| MAPK/ERK kinase kinase 1 (MAP3K1) | Clinical trial Target | Target Info | [5] | ||
| Bone morphogenetic protein receptor (BMPR2) | Literature-reported Target | Target Info | [6] | ||
| Metastasis adhesion protein (MTDH) | Literature-reported Target | Target Info | [7] | ||
| Protein(s) Regulated by This miRNA | GRB2-associated-binding protein 2 | Regulated Protein | [8] | ||
| MHC class I polypeptide-related sequence A | Regulated Protein | [9] | |||
| References | |||||
| REF 1 | The micro-ribonucleic acid (miRNA) miR-206 targets the human estrogen receptor-alpha (ERalpha) and represses ERalpha messenger RNA and protein expression in breast cancer cell lines. Mol Endocrinol. 2007 May;21(5):1132-47. | ||||
| REF 2 | Loss of RACK1 Promotes Metastasis of Gastric Cancer by Inducing a miR-302c/IL8 Signaling Loop. Cancer Res. 2015 Sep 15;75(18):3832-41. | ||||
| REF 3 | The microRNA-302-367 cluster suppresses the proliferation of cervical carcinoma cells through the novel target AKT1. RNA. 2013 Jan;19(1):85-95. | ||||
| REF 4 | MicroRNA let-7b targets important cell cycle molecules in malignant melanoma cells and interferes with anchorage-independent growth. Cell Res. 2008 May;18(5):549-57. | ||||
| REF 5 | MiR-302a/b/c/d cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein(P-gp) by targeting MAP/ERK kinase kinase 1 (MEKK1). J Exp Clin Cancer Res. 2016 Feb 3;35:25. | ||||
| REF 6 | Inhibition of microRNA-302 (miR-302) by bone morphogenetic protein 4 (BMP4) facilitates the BMP signaling pathway. J Biol Chem. 2012 Nov 9;287(46):38656-64. | ||||
| REF 7 | MiR-302c-3p suppresses invasion and proliferation of glioma cells via down-regulating metadherin (MTDH) expression. Cancer Biol Ther. 2015;16(9):1308-15. | ||||
| REF 8 | microRNA-302c-3p inhibits renal cell carcinoma cell proliferation by targeting Grb2-associated binding 2 (Gab2).Oncotarget. 2017 Apr 18;8(16):26334-26343. | ||||
| REF 9 | Downregulation of miR-302c and miR-520c by 1,25(OH)2D3 treatment enhances the susceptibility of tumour cells to natural killer cell-mediated cytotoxicity.Br J Cancer. 2013 Aug 6;109(3):723-30. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.