The microRNAs (miRNAs) Regulating This Target |
Top |
miRNA Mature ID |
hsa-miR-300 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uauacaagggcagacucucucu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Overexpression of miR-300 with mimi repressed p53 expression and miR-300 knockdown by AS dramatically enhanced p53 expression indicating that endogenous miR-300 regulates p53 abundance. |
[3] |
Evidence Score (E-score) |
3 |
+ |
1 |
Immunoprecipitation; Luciferase Reporter Assay; qRT-PCR; Western Blot |
[1] |
2 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[2] |
3 |
Luciferase Reporter Assay; Western Blot |
[3] |
Representative Target(s) Regulated by This miRNA |
Bromodomain-containing protein 7 (BRD7)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-34a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uggcagugucuuagcugguugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Members of miR-34 family, including miR-34a, b and c, were reported as direct targets of p53 protein. |
[5] |
Evidence Score (E-score) |
3 |
+ |
1 |
Immunoblot; Luciferase Reporter Assay; Microarray; Northern Blot; qRT-PCR |
[4] |
2 |
Immunohistochemistry; Immunocytochemistry |
[5] |
3 |
qRT-PCR; Western Blot |
[6] |
Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
Androgen receptor (AR)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-106b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaagugcugacagugcagau
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[7] |
2 |
qRT-PCR |
[8] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-125a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucccugagacccuuuaaccuguga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-125a-5p by mature miRNA precursor transfection resulted in the decreased protein level of target TP53. |
[9] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Northern Blot; qRT-PCR; Western Blot |
[9] |
2 |
qRT-PCR; Western Blot |
[10] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator BAK (BAK)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-150-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucucccaacccuuguaccagug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-150 directly targets the p53 gene by interaction with the 3'UTR. |
[11] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[11] |
2 |
Luciferase Reporter Assay; Western Blot |
[12] |
Representative Target(s) Regulated by This miRNA |
Apoptosis inhibitor survivin (BIRC5)
|
Target Info
|
|
Beta-arrestin-2 (ARRB2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-155-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cuccuacauauuagcauuaaca
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[13] |
2 |
Luciferase Reporter Assay; Western Blot |
[14] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
Erbb2 tyrosine kinase receptor (HER2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-15a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uagcagcacauaaugguuugug
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
HITS-CLIP |
[15] |
2 |
Immunoblot; Luciferase Reporter Assay |
[16] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-18a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaggugcaucuagugcagauag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
qRT-PCR |
[8] |
2 |
RT-PCR |
[17] |
Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-214-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acagcaggcacagacaggcagu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-214 directly interacts with the 3' UTR of p53. |
[19] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[18] |
2 |
Reporter Assay |
[19] |
Representative Target(s) Regulated by This miRNA |
Activating transcription factor 4 (ATF-4)
|
Target Info
|
|
ADP-ribosylation factor-like protein 2 (ARL2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-214-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ugccugucuacacuugcugugc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[20] |
2 |
qRT-PCR; Western Blot |
[21] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
Cyclin-dependent kinase 3 (CDK3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-221-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agcuacauugucugcuggguuuc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[22] |
2 |
Western Blot |
[23] |
Representative Target(s) Regulated by This miRNA |
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
Beclin-1 (BECN1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-27a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uucacaguggcuaaguuccgc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-27a is binding directly to the p53 30-UTR. |
[25] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay |
[24] |
2 |
qRT-PCR |
[25] |
Representative Target(s) Regulated by This miRNA |
ATP-binding cassette transporter A1 (ABCA1)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-30d-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uguaaacauccccgacuggaag
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-30 directly target the 3'UTR of TP53 to downregulate p53 protein levels and reduce the expression of genes that are transcriptionally activated by p53. |
[27] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; qRT-PCR; Western Blot |
[26] |
2 |
Luciferase Reporter Assay; Western Blot |
[27] |
Representative Target(s) Regulated by This miRNA |
Autophagy-related 2B (ATG2B)
|
Target Info
|
|
Beclin-1 (BECN1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-377-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aucacacaaaggcaacuuuugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-377 downregulated p53, expression by directly targeting the 3'-untranslated region of TP53. |
[28] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[28] |
2 |
Luciferase Reporter Assay; Western Blot; RT-PCR |
[28] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
DNA [cytosine-5]-methyltransferase 1 (DNMT1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-638 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agggaucgcgggcggguggcggccu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Inhibition of endogenous miR-638 resulted in a significant upregulation p53 protein levels. |
[29] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[29] |
2 |
qRT-PCR |
[30] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
Cyclin-dependent kinase 2 (CDK2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-151a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucgaggagcucacagucuagu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-151-5p could target 3'-untranslated region (3'UTR) of p53 mRNA and downregulate p53 level in SC-M1 cells. |
[31] |
Evidence Score (E-score) |
2 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[31] |
2 |
Luciferase Reporter Assay; Western Blot |
[32] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
Thrombopoietin receptor (MPL)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-605-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaaucccauggugccuucuccu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
2 |
+ |
1 |
qRT-PCR |
[33] |
2 |
Reporter Assay |
[19] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
Gankyrin (PSMD10)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-106a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaaagugcuuacagugcagguag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR |
[8] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-10b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uacccuguagaaccgaauuugug
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miRNA-10b is a target gene of TP53 to regulate invasiveness of U87-2M1 glioma cells. |
[34] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[34] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
Cyclic AMP-responsive element-binding protein (CREB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-17-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagugcuuacagugcagguag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR |
[8] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-200a-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaacacugucugguaacgaugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-200a caused a significant down- regulation of p53 protein levels in cells with a WT 3'UTR. |
[35] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[35] |
Representative Target(s) Regulated by This miRNA |
Amphiregulin (AREG)
|
Target Info
|
|
Beta-catenin (CTNNB1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-20a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uaaagugcuuauagugcagguag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR |
[8] |
Representative Target(s) Regulated by This miRNA |
Amyloid beta A4 protein (APP)
|
Target Info
|
|
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-222-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agcuacaucuggcuacugggu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot |
[23] |
Representative Target(s) Regulated by This miRNA |
AN1-type zinc finger protein 5 (ZFAND5)
|
Target Info
|
|
ATP-binding cassette transporter G2 (ABCG2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-25-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cauugcacuugucucggucuga
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
miR-25 directly target the 3'UTR of TP53 to downregulate p53 protein levels and reduce the expression of genes that are transcriptionally activated by p53. |
[27] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[27] |
Representative Target(s) Regulated by This miRNA |
CDK inhibitor 1C p57Kip2 (CDKN1C)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-26a-1-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ccuauucuugguuacuugcacg
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[36] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Caspase-3 (CASP3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-28-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aaggagcucacagucuauugag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[37] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
Extracellular signal-regulated kinase 2 (ERK2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-30a-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uguaaacauccucgacuggaag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[26] |
Representative Target(s) Regulated by This miRNA |
Beclin-1 (BECN1)
|
Target Info
|
|
Brain-derived neurotrophic factor (BDNF)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-30b-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uguaaacauccuacacucagcu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[26] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-2 (BCL-2)
|
Target Info
|
|
Beclin-1 (BECN1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-30e-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
uguaaacauccuugacuggaag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[26] |
Representative Target(s) Regulated by This miRNA |
Caspase-3 (CASP3)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-491-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aguggggaacccuuccaugagg
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Overexpression of miR-491-5p in the pancreatic cancer cell line SW1990 effectively inhibited endogenous Bcl-XL TP53 gene expressions. |
[38] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[38] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-xL (BCL-xL)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-504-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agacccuggucugcacucuauc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Reporter Assay; Western Blot |
[25] |
Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
Bcl-2-binding component 3 (BBC3)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-663a |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aggcggggcgccgcgggaccgc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
ZNF224 increased miR-663a transcription by binding to miR-663a promoter, which in turn bound to 3'UTR of p53 and p21 to decrease their expression. |
[39] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[39] |
Representative Target(s) Regulated by This miRNA |
C-X-C chemokine receptor type 4 (CXCR4)
|
Target Info
|
|
CCAAT/enhancer binding protein beta (CEBPB)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-92a-1-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agguugggaucgguugcaaugcu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR |
[8] |
Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-1228-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucacaccugccucgcccccc
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Ectopic expression of miR-1228 decreased the amount of p53 mRNA and protein. |
[40] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Immunohistochemistry; Western Blot |
[40] |
Representative Target(s) Regulated by This miRNA |
BMP-2-inducible protein kinase (BMP2K)
|
Target Info
|
|
Casein kinase II alpha prime (CSNK2A2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-125b-1-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
acggguuaggcucuugggagcu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[41] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
ERK activator kinase 7 (MAP2K7)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-150-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cugguacaggccugggggacag
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR; Western Blot |
[42] |
Representative Target(s) Regulated by This miRNA |
Beta-catenin (CTNNB1)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-485-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
agaggcuggccgugaugaauuc
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR |
[25] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
Frizzled-7 receptor (FZD7)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-518c-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
caaagcgcuucucuuuagagugu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
Overexpression of miR-518c-3p downregulated the expression of 5'UTR plus coding sequence (CDS) constructs, suggesting that their effect on p53 is partly 3'UTR independent. |
[29] |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[29] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
Estradiol 17 beta-dehydrogenase 1 (17-beta-HSD1)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-608 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
aggggugguguugggacagcuccgu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR |
[25] |
Representative Target(s) Regulated by This miRNA |
Apoptosis regulator Bcl-xL (BCL-xL)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-612 |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
gcugggcagggcuucugagcuccuu
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay; Western Blot |
[43] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
RAC-beta serine/threonine-protein kinase (AKT2)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-92a-2-5p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ggguggggauuuguugcauuac
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
qRT-PCR |
[8] |
Representative Target(s) Regulated by This miRNA |
Apoptosis mediating surface antigen FAS (FAS)
|
Target Info
|
|
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-1285-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
ucugggcaacaaagugagaccu
|
miRNA Species |
Homo sapiens |
Regulation Mechanism |
The overexpression of miR-1285-3p by mature miRNA mimics tranfection resulted in the decreased protein level of target TP53. |
[9] |
Evidence Score (E-score) |
1 |
+ |
1 |
Western Blot; qRT-PCR; Luciferase Reporter Assay |
[9] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|
miRNA Mature ID |
hsa-miR-28-3p |
miRNA Info
|
miRNA Mature AC |
|
Sequence |
cacuagauugugagcuccugga
|
miRNA Species |
Homo sapiens |
Evidence Score (E-score) |
1 |
+ |
1 |
Luciferase Reporter Assay |
[37] |
Representative Target(s) Regulated by This miRNA |
Cellular tumor antigen p53 (TP53)
|
Target Info
|
|