miRNA General Information
miRNA Mature ID	hsa-miR-485-5p
miRNA Stemloop AC	MI0002469
miRNA Stemloop ID	hsa-mir-485
Sequence	agaggcuggccgugaugaauuc
TTD Target(s) Regulated by This miRNA	Cellular tumor antigen p53 (TP53)	Clinical trial Target	Target Info	[1]
	Frizzled-7 receptor (FZD7)	Clinical trial Target	Target Info	[2]
	High mobility group protein HMGI-C (HMGA2)	Literature-reported Target	Target Info	[3]
	Stanniocalcin-2 (STC2)	Literature-reported Target	Target Info	[4]
Protein(s) Regulated by This miRNA	Apolipoprotein A-V	Regulated Protein	APOA5_HUMAN	[5]
	Flotillin-1	Regulated Protein	FLOT1_HUMAN	[6]
	Hypoxia-inducible factor 3-alpha	Regulated Protein	HIF3A_HUMAN	[7]
	Peroxisome proliferator-activated receptor gamma coactivator 1-alpha	Regulated Protein	PRGC1_HUMAN	[8]
References
REF 1	Negative regulation of tumor suppressor p53 by microRNA miR-504. Mol Cell. 2010 Jun 11;38(5):689-99.
REF 2	MicroRNA-485-5p represses melanoma cell invasion and proliferation by suppressing Frizzled7. Biomed Pharmacother. 2017 Jun;90:303-310.
REF 3	miR 85 p inhibits bladder cancer metastasis by targeting HMGA2. Int J Mol Med. 2015 Oct;36(4):1136-42.
REF 4	MicroRNA-485-5p suppresses cell proliferation and invasion in hepatocellular carcinoma by targeting stanniocalcin 2. Int J Clin Exp Pathol. 2015 Oct 1;8(10):12292-9.
REF 5	An APOA5 3' UTR variant associated with plasma triglycerides triggers APOA5 downregulation by creating a functional miR-485-5p binding site.Am J Hum Genet. 2014 Jan 2;94(1):129-34.
REF 6	miR-485-5p acts as a negative regulator in gastric cancer progression by targeting flotillin-1. Am J Transl Res. 2015 Nov 15;7(11):2212-22.
REF 7	MicroRNA response to hypoxic stress in soft tissue sarcoma cells: microRNA mediated regulation of HIF3.BMC Cancer. 2014 Jun 13;14:429.
REF 8	MiR-485-3p and miR-485-5p suppress breast cancer cell metastasis by inhibiting PGC-1 expression.Cell Death Dis. 2016 Mar 24;7:e2159.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.