miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-504-5p | ||||
| miRNA Stemloop AC | MI0003189 | ||||
| miRNA Stemloop ID | hsa-mir-504 | ||||
| Sequence | agacccuggucugcacucuauc | ||||
| TTD Target(s) Regulated by This miRNA | Cyclin-dependent kinase 6 (CDK6) | Successful Target | Target Info | [1] | |
| Dopamine D1 receptor (D1R) | Successful Target | Target Info | [2] | ||
| Vascular endothelial growth factor A (VEGFA) | Successful Target | Target Info | [3] | ||
| Ubiquitin-protein ligase E3 Mdm2 (MDM2) | Clinical trial Target | Target Info | [4] | ||
| Cellular tumor antigen p53 (TP53) | Clinical trial Target | Target Info | [4] | ||
| Apoptosis mediating surface antigen FAS (FAS) | Clinical trial Target | Target Info | [4] | ||
| Trefoil factor-1 (TFF1) | Clinical trial Target | Target Info | [5] | ||
| Bcl-2-binding component 3 (BBC3) | Literature-reported Target | Target Info | [4] | ||
| Protein(s) Regulated by This miRNA | Apoptosis regulator BAX | Regulated Protein | [4] | ||
| Growth arrest and DNA damage-inducible protein GADD45 alpha | Regulated Protein | [4] | |||
| Quinone oxidoreductase PIG3 | Regulated Protein | [4] | |||
| Transcription elongation factor A protein-like 1 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | microRNA-504 inhibits cancer cell proliferation via targeting CDK6 in hypopharyngeal squamous cell carcinoma. Int J Oncol. 2014 Jun;44(6):2085-92. | ||||
| REF 2 | Differential allelic expression of dopamine D1 receptor gene (DRD1) is modulated by microRNA miR-504. Biol Psychiatry. 2009 Apr 15;65(8):702-5. | ||||
| REF 3 | The effect of central loops in miRNA:MRE duplexes on the efficiency of miRNA-mediated gene regulation. PLoS One. 2008 Mar 5;3(3):e1719. | ||||
| REF 4 | Negative regulation of tumor suppressor p53 by microRNA miR-504. Mol Cell. 2010 Jun 11;38(5):689-99. | ||||
| REF 5 | TFF1 activates p53 through down-regulation of miR-504 in gastric cancer. Oncotarget. 2014 Jul 30;5(14):5663-73. | ||||
| REF 6 | Negative regulation of tumor suppressor p53 by microRNA miR-504. Mol Cell. 2010 Jun 11;38(5):689-99. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.