Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T39855 Target Info
Target Name Melanoma differentiation-associated protein 6 (CDKN1A)
Synonyms WAF1; SDI1; PIC1; P21(WAF1); P21; Melanoma differentiation associated protein 6; MDA6; MDA-6; Cyclin-dependent kinase inhibitor 1; CIP1; CDK-interacting protein 1; CAP20
Target Type Literature-reported Target
Gene Name CDKN1A
UniProt ID
P38936
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-106b-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target CDKN1A. [3]
Evidence Score (E-score) 13 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [4]
5 Luciferase Reporter Assay; Microarray; Western Blot [5]
6 Luciferase Reporter Assay; qRT-PCR [6]
7 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
8 qRT-PCR; Luciferase Reporter Assay; Western Blot [8]
9 qRT-PCR; Luciferase Reporter Assay; Western Blot [9]
10 qRT-PCR; Luciferase Reporter Assay; Western Blot [10]
11 qRT-PCR; Luciferase Reporter Assay; Western Blot; Microarray [11]
12 qRT-PCR; Western Blot [12]
13 Reporter Assay; Western Blot; qRT-PCR [13]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-17-5p by mature miRNA precursor transfection resulted in the decreased protein level of target CDKN1A. [3]
Evidence Score (E-score) 11 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR [14]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [15]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [16]
5 Luciferase Reporter Assay; qRT-PCR; Western Blot [17]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [18]
7 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
8 Luciferase Reporter Assay; Western Blot [19]
9 qRT-PCR; Luciferase Reporter Assay; Western Blot [8]
10 qRT-PCR; Luciferase Reporter Assay; Western Blot [10]
11 qRT-PCR; Western Blot; Northern Blot; Luciferase Reporter Assay [20]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-93-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target CDKN1A. [3]
Evidence Score (E-score) 6 +
1 Luciferase Reporter Assay; Microarray; Western Blot [5]
2 Luciferase Reporter Assay; Western Blot [21]
3 qRT-PCR; Luciferase Reporter Assay; Western Blot [8]
4 qRT-PCR; Luciferase Reporter Assay; Western Blot [9]
5 qRT-PCR; Luciferase Reporter Assay; Western Blot [3]
6 qRT-PCR; Western Blot [22]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-106a-5p by mature miRNA mimics tranfection resulted in the decreased protein level of target CDKN1A. [3]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay; Western Blot [23]
2 Luciferase Reporter Assay; Western Blot [3]
3 qRT-PCR; Luciferase Reporter Assay; Western Blot [8]
4 qRT-PCR; Luciferase Reporter Assay; Western Blot [10]
5 qRT-PCR; Luciferase Reporter Assay; Western Blot; Microarray [11]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; [14]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [18]
4 qRT-PCR; Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-let-7b-5p miRNA Info
miRNA Mature AC
MIMAT0000063
Sequence ugagguaguagguugugugguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunoblot; Microarray; qRT-PCR [24]
2 PAR-CLIP [25]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism miR-145 is the most widely studied miRNA in cancer, especially in PC, and it inhibits the expression of c-MYC and CDKNIA, which play important roles in CRPC. [26]
Evidence Score (E-score) 2 +
1 qRT-PCR; Luciferase Reporter Assay; Western Blot [8]
2 Western Blot [26]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-20b-5p miRNA Info
miRNA Mature AC
MIMAT0001413
Sequence caaagugcucauagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [10]
2 qRT-PCR; Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [27]
2 PAR-CLIP [25]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-372-3p miRNA Info
miRNA Mature AC
MIMAT0000724
Sequence aaagugcugcgacauuugagcgu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [10]
2 qRT-PCR; Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA ATPase family AAA domain containing 2 (ATAD2) Target Info
ATAD2_HUMAN
B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
miRNA Mature ID hsa-miR-519d-3p miRNA Info
miRNA Mature AC
MIMAT0002853
Sequence caaagugccucccuuuagagug
miRNA Species Homo sapiens
Regulation Mechanism miR-519d targets CDKN1A in HCC. [28]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [28]
2 qRT-PCR; Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Calcium-release activated calcium channel (CRACM) Target Info
CRCM1_HUMAN
E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
miRNA Mature ID hsa-miR-663a miRNA Info
miRNA Mature AC
MIMAT0003326
Sequence aggcggggcgccgcgggaccgc
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [29]
2 PAR-CLIP [30]
Representative Target(s) Regulated by This miRNA C-X-C chemokine receptor type 4 (CXCR4) Target Info
CXCR4_HUMAN
CCAAT/enhancer binding protein beta (CEBPB) Target Info
CEBPB_HUMAN
miRNA Mature ID hsa-miR-96-5p miRNA Info
miRNA Mature AC
MIMAT0000095
Sequence uuuggcacuagcacauuuuugcu
miRNA Species Homo sapiens
Regulation Mechanism The expression level of CDKN1A protein was significantly up-regulated in two human BC cell lines T24 and EJ transfected with miR- 96 inhibitor. [31]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [4]
2 Luciferase Reporter Assay; Western Blot [31]
Representative Target(s) Regulated by This miRNA 5-HT 1B receptor (HTR1B) Target Info
5HT1B_HUMAN
ALK tyrosine kinase receptor (ALK) Target Info
ALK_HUMAN
miRNA Mature ID hsa-miR-208a-3p miRNA Info
miRNA Mature AC
MIMAT0000241
Sequence auaagacgagcaaaaagcuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-208 significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [32]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
Protein C-ets-1 (ETS1) Target Info
ETS1_HUMAN
miRNA Mature ID hsa-miR-208b-3p miRNA Info
miRNA Mature AC
MIMAT0004960
Sequence auaagacgaacaaaagguuugu
miRNA Species Homo sapiens
Regulation Mechanism miR-208b significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [33]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
Voltage-gated calcium channel alpha Cav1.2 (CACNA1C) Target Info
CAC1C_HUMAN
miRNA Mature ID hsa-miR-299-5p miRNA Info
miRNA Mature AC
MIMAT0002890
Sequence ugguuuaccgucccacauacau
miRNA Species Homo sapiens
Regulation Mechanism miR-299 significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [34]
2 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
Osteopontin (SPP1) Target Info
OSTP_HUMAN
miRNA Mature ID hsa-miR-10b-5p miRNA Info
miRNA Mature AC
MIMAT0000254
Sequence uacccuguagaaccgaauuugug
miRNA Species Homo sapiens
Regulation Mechanism miR-10b directly regulates CDKN1A. [35]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [35]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
MIMAT0000426
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Regulation Mechanism miR-132 significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-146a-5p miRNA Info
miRNA Mature AC
MIMAT0000449
Sequence ugagaacugaauuccauggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Activation B7-1 antigen (CD80) Target Info
CD80_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-146b-5p miRNA Info
miRNA Mature AC
MIMAT0002809
Sequence ugagaacugaauuccauaggcug
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA Calgranulin D (S100A12) Target Info
S10AC_HUMAN
DNA-binding factor KBF1 (p105) Target Info
NFKB1_HUMAN
miRNA Mature ID hsa-miR-182-5p miRNA Info
miRNA Mature AC
MIMAT0000259
Sequence uuuggcaaugguagaacucacacu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-203a-5p miRNA Info
miRNA Mature AC
MIMAT0031890
Sequence agugguucuuaacaguucaacaguu
miRNA Species Homo sapiens
Regulation Mechanism miR203 overexpression increased the levels of cell-cycle inhibitor p21. [36]
Evidence Score (E-score) 1 +
1 Western Blot [36]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism The downregulation of miR-21-5p by LNA Antisense miRNA Oligonucleotides resulted in the changed mRNA level of target CDKN1A. [3]
Evidence Score (E-score) 1 +
1 qRT-PCR [3]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-28-5p miRNA Info
miRNA Mature AC
MIMAT0000085
Sequence aaggagcucacagucuauugag
miRNA Species Homo sapiens
Regulation Mechanism miR-28 significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Extracellular signal-regulated kinase 2 (ERK2) Target Info
MK01_HUMAN
miRNA Mature ID hsa-miR-302a-3p miRNA Info
miRNA Mature AC
MIMAT0000684
Sequence uaagugcuuccauguuuugguga
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-302a resulted in decreased luciferase activity, indicating that it directly interact with the 3'UTR of p21Waf1/Cip1. [2]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [2]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cyclin-dependent kinase 1 (CDK1) Target Info
CDK1_HUMAN
miRNA Mature ID hsa-miR-363-3p miRNA Info
miRNA Mature AC
MIMAT0000707
Sequence aauugcacgguauccaucugua
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Regulation Mechanism CDKN1A is a target of miR-503. [37]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [37]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
miRNA Mature ID hsa-miR-519c-3p miRNA Info
miRNA Mature AC
MIMAT0002832
Sequence aaagugcaucuuuuuagaggau
miRNA Species Homo sapiens
Regulation Mechanism A direct binding of miR-519c-3p to the 3' UTRs of CDKN1A was demonstrated by a luciferase-reporter assay. [28]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [28]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
ELAV-like protein 1 (ELAVL1) Target Info
ELAV1_HUMAN
miRNA Mature ID hsa-miR-520a-3p miRNA Info
miRNA Mature AC
MIMAT0002834
Sequence aaagugcuucccuuuggacugu
miRNA Species Homo sapiens
Regulation Mechanism miR-520a significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-298 miRNA Info
miRNA Mature AC
MIMAT0004901
Sequence agcagaagcagggagguucuccca
miRNA Species Homo sapiens
Regulation Mechanism miR-298 significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
miRNA Mature ID hsa-miR-345-5p miRNA Info
miRNA Mature AC
MIMAT0000772
Sequence gcugacuccuaguccagggcuc
miRNA Species Homo sapiens
Regulation Mechanism miR-345 significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
Multidrug resistance-associated protein 1 (ABCC1) Target Info
MRP1_HUMAN
miRNA Mature ID hsa-miR-4295 miRNA Info
miRNA Mature AC
MIMAT0016844
Sequence cagugcaauguuuuccuu
miRNA Species Homo sapiens
Regulation Mechanism miR-4295 directly targeted the 3'UTR region of CDKN1A and negatively regulated its expression. [38]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [38]
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
Runt-related transcription factor 3 (RUNX3) Target Info
RUNX3_HUMAN
miRNA Mature ID hsa-miR-519b-3p miRNA Info
miRNA Mature AC
MIMAT0002837
Sequence aaagugcauccuuuuagagguu
miRNA Species Homo sapiens
Regulation Mechanism miR-519b significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA ELAV-like protein 1 (ELAVL1) Target Info
ELAV1_HUMAN
Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
miRNA Mature ID hsa-miR-520h miRNA Info
miRNA Mature AC
MIMAT0002867
Sequence acaaagugcuucccuuuagagu
miRNA Species Homo sapiens
Regulation Mechanism miR-520h significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
Histone deacetylase 1 (HDAC1) Target Info
HDAC1_HUMAN
miRNA Mature ID hsa-miR-639 miRNA Info
miRNA Mature AC
MIMAT0003309
Sequence aucgcugcgguugcgagcgcugu
miRNA Species Homo sapiens
Regulation Mechanism miR-639 significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Forkhead box protein C1 (FOXC1) Target Info
FOXC1_HUMAN
Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
miRNA Mature ID hsa-miR-657 miRNA Info
miRNA Mature AC
MIMAT0003335
Sequence ggcagguucucacccucucuagg
miRNA Species Homo sapiens
Regulation Mechanism miR-657 significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA CI Man-6-P receptor (IGF2R) Target Info
MPRI_HUMAN
Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
miRNA Mature ID hsa-miR-942-5p miRNA Info
miRNA Mature AC
MIMAT0004985
Sequence ucuucucuguuuuggccaugug
miRNA Species Homo sapiens
Regulation Mechanism miR-942 significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Glycogen synthase kinase-3 beta (GSK-3B) Target Info
GSK3B_HUMAN
Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
miRNA Mature ID hsa-miR-95-3p miRNA Info
miRNA Mature AC
MIMAT0000094
Sequence uucaacggguauuuauugagca
miRNA Species Homo sapiens
Regulation Mechanism miR-95-3p is a potential new marker for HCC and regulates hepatocarcinogenesis by directly targeting CDKN1A/p21 expression. [39]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [39]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
miRNA Mature ID hsa-miR-423-3p miRNA Info
miRNA Mature AC
MIMAT0001340
Sequence agcucggucugaggccccucagu
miRNA Species Homo sapiens
Regulation Mechanism miR-423 significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
miRNA Mature ID hsa-miR-519e-3p miRNA Info
miRNA Mature AC
MIMAT0002829
Sequence aagugccuccuuuuagaguguu
miRNA Species Homo sapiens
Regulation Mechanism miR-519e significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
miRNA Mature ID hsa-miR-572 miRNA Info
miRNA Mature AC
MIMAT0003237
Sequence guccgcucggcgguggccca
miRNA Species Homo sapiens
Regulation Mechanism miR-572 significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
miRNA Mature ID hsa-miR-654-3p miRNA Info
miRNA Mature AC
MIMAT0004814
Sequence uaugucugcugaccaucaccuu
miRNA Species Homo sapiens
Regulation Mechanism miR-654 significantly decreased the luciferase activity of the CDKN1A. [8]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Melanoma differentiation-associated protein 6 (CDKN1A) Target Info
CDN1A_HUMAN
References  Top
REF 1 MicroRNAs MiR-17, MiR-20a, and MiR-106b act in concert to modulate E2F activity on cell cycle arrest during neuronal lineage differentiation of USSC. PLoS One. 2011 Jan 20;6(1):e16138.
REF 2 Multiple microRNAs rescue from Ras-induced senescence by inhibiting p21(Waf1/Cip1). Oncogene. 2010 Apr 15;29(15):2262-71.
REF 3 Programmed cell death 4 (PDCD4) is an important functional target of the microRNA miR-21 in breast cancer cells. J Biol Chem. 2008 Jan 11;283(2):1026-33.
REF 4 The miR-106b-25 polycistron, activated by genomic amplification, functions as an oncogene by suppressing p21 and Bim. Gastroenterology. 2009 May;136(5):1689-700.
REF 5 E2F1-regulated microRNAs impair TGFbeta-dependent cell-cycle arrest and apoptosis in gastric cancer. Cancer Cell. 2008 Mar;13(3):272-86.
REF 6 Genomic profiling of microRNA and messenger RNA reveals deregulated microRNA expression in prostate cancer. Cancer Res. 2008 Aug 1;68(15):6162-70.
REF 7 MiR-106b induces cell radioresistance via the PTEN/PI3K/AKT pathways and p21 in colorectal cancer. J Transl Med. 2015 Aug 4;13:252.
REF 8 Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8.
REF 9 Functional links between clustered microRNAs: suppression of cell-cycle inhibitors by microRNA clusters in gastric cancer. Nucleic Acids Res. 2009 Apr;37(5):1672-81.
REF 10 MicroRNAs in the miR-106b family regulate p21/CDKN1A and promote cell cycle progression. Mol Cell Biol. 2008 Apr;28(7):2167-74.
REF 11 High-risk myeloma is associated with global elevation of miRNAs and overexpression of EIF2C2/AGO2. Proc Natl Acad Sci U S A. 2010 Apr 27;107(17):7904-9.
REF 12 Effects of microRNA-106 on proliferation of gastric cancer cell through regulating p21 and E2F5. Asian Pac J Cancer Prev. 2013;14(5):2839-43.
REF 13 miR-106b aberrantly expressed in a double transgenic mouse model for Alzheimer's disease targets TGF- type II receptor. Brain Res. 2010 Oct 21;1357:166-74.
REF 14 MicroRNA-17-92 down-regulates expression of distinct targets in different B-cell lymphoma subtypes. Blood. 2009 Jan 8;113(2):396-402.
REF 15 MiR-17-5p promotes cancer cell proliferation and tumorigenesis in nasopharyngeal carcinoma by targeting p21. Cancer Med. 2016 Dec;5(12):3489-3499.
REF 16 The regulatory and predictive functions of miR-17 and miR-92 families on cisplatin resistance of non-small cell lung cancer. BMC Cancer. 2015 Oct 19;15:731.
REF 17 SS18-SSX-regulated miR-17 promotes tumor growth of synovial sarcoma by inhibiting p21WAF1/CIP1. Cancer Sci. 2014 Sep;105(9):1152-9.
REF 18 miR-17-5p/20a are important markers for gastric cancer and murine double minute 2 participates in their functional regulation. Eur J Cancer. 2013 May;49(8):2010-21.
REF 19 mir-17-92, a cluster of miRNAs in the midst of the cancer network. Int J Biochem Cell Biol. 2010 Aug;42(8):1348-54.
REF 20 Antagomir-17-5p abolishes the growth of therapy-resistant neuroblastoma through p21 and BIM. PLoS One. 2008 May 21;3(5):e2236.
REF 21 MicroRNA-93 promotes the malignant phenotypes of human glioma cells and induces their chemoresistance to temozolomide. Biol Open. 2016 Jun 15;5(6):669-77.
REF 22 MicroRNA-93-5p increases multidrug resistance in human colorectal carcinoma cells by downregulating cyclin dependent kinase inhibitor 1A gene expression. Oncol Lett. 2017 Feb;13(2):722-730.
REF 23 Alterations in microRNA expression in stress-induced cellular senescence. Mech Ageing Dev. 2009 Nov-Dec;130(11-12):731-41.
REF 24 DICER-dependent biogenesis of let-7 miRNAs affects human cell response to DNA damage via targeting p21/p27. Nucleic Acids Res. 2015 Feb 18;43(3):1626-36.
REF 25 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 26 Screening key microRNAs for castration-resistant prostate cancer based on miRNA/mRNA functional synergistic network. Oncotarget. 2015 Dec 22;6(41):43819-30.
REF 27 MicroRNA-22 is down-regulated in hepatitis B virus-related hepatocellular carcinoma. Biomed Pharmacother. 2013 Jun;67(5):375-80.
REF 28 In hepatocellular carcinoma miR-519d is up-regulated by p53 and DNA hypomethylation and targets CDKN1A/p21, PTEN, AKT3 and TIMP2. J Pathol. 2012 Jul;227(3):275-85.
REF 29 ZNF224, Krpel like zinc finger protein, induces cell growth and apoptosis-resistance by down-regulation of p21 and p53 via miR-663a. Oncotarget. 2016 May 24;7(21):31177-90.
REF 30 TP53 regulates miRNA association with AGO2 to remodel the miRNA-mRNA interaction network. Genome Res. 2016 Mar;26(3):331-41.
REF 31 Upregulation of microRNA-96 and its oncogenic functions by targeting CDKN1A in bladder cancer. Cancer Cell Int. 2015 Nov 14;15:107.
REF 32 Radiation-induced miR-208a increases the proliferation and radioresistance by targeting p21 in human lung cancer cells. J Exp Clin Cancer Res. 2016 Jan 12;35:7.
REF 33 Clinical impact of circulating miR-26a, miR-191, and miR-208b in plasma of patients with acute myocardial infarction. Eur J Med Res. 2015 Jun 5;20:58.
REF 34 miR-299-5p promotes cell growth and regulates G1/S transition by targeting p21Cip1/Waf1 in acute promyelocytic leukemia. Oncol Lett. 2016 Jul;12(1):741-747.
REF 35 Human glioma growth is controlled by microRNA-10b. Cancer Res. 2011 May 15;71(10):3563-72.
REF 36 MicroRNA-203 Regulates Growth and Metastasis of Breast Cancer. Cell Physiol Biochem. 2015;37(1):35-42.
REF 37 Induction of microRNAs, mir-155, mir-222, mir-424 and mir-503, promotes monocytic differentiation through combinatorial regulation. Leukemia. 2010 Feb;24(2):460-6.
REF 38 miR-4295 promotes cell proliferation and invasion in anaplastic thyroid carcinoma via CDKN1A. Biochem Biophys Res Commun. 2015 Sep 4;464(4):1309-1313.
REF 39 Up-regulation of miR-95-3p in hepatocellular carcinoma promotes tumorigenesis by targeting p21 expression. Sci Rep. 2016 Oct 4;6:34034.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.