miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-423-3p | ||||
| miRNA Stemloop AC | MI0001445 | ||||
| miRNA Stemloop ID | hsa-mir-423 | ||||
| Sequence | agcucggucugaggccccucagu | ||||
| TTD Target(s) Regulated by This miRNA | Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Bcl-2-like protein 11 | Regulated Protein | [2] | ||
| Proliferation-associated protein 2G4 | Regulated Protein | [3] | |||
| Transcription elongation factor A protein-like 1 | Regulated Protein | [4] | |||
| References | |||||
| REF 1 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
| REF 2 | The microRNA-423-3p-Bim Axis Promotes Cancer Progression and Activates Oncogenic Autophagy in Gastric Cancer.Mol Ther. 2017 Apr 5;25(4):1027-1037. | ||||
| REF 3 | The polymorphism of rs6505162 in the MIR423 coding region and recurrent pregnancy loss.Reproduction. 2015 Jul;150(1):65-76. | ||||
| REF 4 | MiR-423-3p enhances cell growth through inhibition of p21Cip1/Waf1 in colorectal cancer.Cell Physiol Biochem. 2015;37(3):1044-54. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.