miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-654-3p | ||||
| miRNA Stemloop AC | MI0003676 | ||||
| miRNA Stemloop ID | hsa-mir-654 | ||||
| Sequence | uaugucugcugaccaucaccuu | ||||
| TTD Target(s) Regulated by This miRNA | Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [1] | |
| Protein(s) Regulated by This miRNA | Nuclease EXOG, mitochondrial | Regulated Protein | [2] | ||
| References | |||||
| REF 1 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
| REF 2 | Integrated mRNA and micro RNA profiling reveals epigenetic mechanism of differential sensitivity of Jurkat T cells to AgNPs and Ag ions.Toxicol Lett. 2014 Aug 17;229(1):311-8. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.