miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-299-5p | ||||
| miRNA Stemloop AC | MI0000744 | ||||
| miRNA Stemloop ID | hsa-mir-299 | ||||
| Sequence | ugguuuaccgucccacauacau | ||||
| TTD Target(s) Regulated by This miRNA | Melanoma differentiation-associated protein 6 (CDKN1A) | Literature-reported Target | Target Info | [1] | |
| Osteopontin (SPP1) | Literature-reported Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Autophagy protein 5 | Regulated Protein | [3] | ||
| References | |||||
| REF 1 | Multiple microRNAs modulate p21Cip1/Waf1 expression by directly targeting its 3' untranslated region. Oncogene. 2010 Apr 15;29(15):2302-8. | ||||
| REF 2 | Spheroid-forming subpopulation of breast cancer cells demonstrates vasculogenic mimicry via hsa-miR-299-5p regulated de novo expression of osteopontin. J Cell Mol Med. 2010 Jun;14(6B):1693-706. | ||||
| REF 3 | MiR-299-5p regulates apoptosis through autophagy in neurons and ameliorates cognitive capacity in APPswe/PS1dE9 mice.Sci Rep. 2016 Apr 15;6:24566. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.