Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T29130 Target Info
Target Name Signal transducer and activator of transcription 3 (STAT3)
Synonyms Acute-phase response factor; APRF
Target Type Successful Target
Gene Name STAT3
Biochemical Class Transcription factor
UniProt ID
P40763
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-106a can directly regulate the expression of STAT3 via binding to its 3' UTR. [1]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
3 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-21-5p by mature miRNA precursor transfection resulted in the decreased protein level of target STAT3. [6]
Evidence Score (E-score) 3 +
1 ELISA; qRT-PCR; Western Blot [4]
2 Western Blot [5]
3 Western Blot [6]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Regulation Mechanism STAT3 was downstream target gene of miR-106b. Overexpression of MDM2 inhibited Dicer by repressing p63 to create a positive feedback loop involving SP1/MDM2/p63/Dicer that leads to inhibition of miR-375 and miR-106b expression. [8]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [2]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
3 Luciferase Reporter Assay; Western Blot [8]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-130b-3p miRNA Info
miRNA Mature AC
MIMAT0000691
Sequence cagugcaaugaugaaagggcau
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [9]
2 qRT-PCR; Western Blot [10]
Representative Target(s) Regulated by This miRNA Acyl-CoA desaturase (SCD) Target Info
ACOD_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-148a-3p miRNA Info
miRNA Mature AC
MIMAT0000243
Sequence ucagugcacuacagaacuuugu
miRNA Species Homo sapiens
Regulation Mechanism Upregulation of miR-148a significantly decreased signal transducer and activator of transcription 3 (STAT3) expression and 3'UTR luciferase activity. [11]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [11]
2 Western Blot [12]
Representative Target(s) Regulated by This miRNA Activated leukocyte cell adhesionmolecule (ALCAM) Target Info
CD166_HUMAN
Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-17 directly target STAT3. [14]
Evidence Score (E-score) 2 +
1 Immunoblot; Luciferase Reporter Assay [13]
2 Luciferase Reporter Assay; Northern Blot; Western Blot [14]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-200a-3p miRNA Info
miRNA Mature AC
MIMAT0000682
Sequence uaacacugucugguaacgaugu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 qRT-PCR [15]
2 Western Blot [16]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-20a directly targets STAT3. [14]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [14]
2 qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-21-3p miRNA Info
miRNA Mature AC
MIMAT0004494
Sequence caacaccagucgaugggcugu
miRNA Species Homo sapiens
Regulation Mechanism STAT3 was a target gene of miR-21 and, as STAT3 protein regulates miR-21 expression by binding to the miR-21 gene promoter. [17]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [17]
2 Western Blot; PCR [18]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Phosphatase and tensin homolog (PTEN) Target Info
PTEN_HUMAN
miRNA Mature ID hsa-let-7c-5p miRNA Info
miRNA Mature AC
MIMAT0000064
Sequence ugagguaguagguuguaugguu
miRNA Species Homo sapiens
Regulation Mechanism STAT3 was a targeting of miRNA let-7c. [19]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [19]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-xL (BCL-xL) Target Info
B2CL1_HUMAN
Caspase-3 (CASP3) Target Info
CASP3_HUMAN
miRNA Mature ID hsa-miR-125a-5p miRNA Info
miRNA Mature AC
MIMAT0000443
Sequence ucccugagacccuuuaaccuguga
miRNA Species Homo sapiens
Regulation Mechanism miR-125a decreased STAT3 3'UTR reporter activity. [20]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [20]
Representative Target(s) Regulated by This miRNA Apoptosis regulator BAK (BAK) Target Info
BAK_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-20b-5p miRNA Info
miRNA Mature AC
MIMAT0001413
Sequence caaagugcucauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism STAT3 functions as a target for miR-20b in MCF-7 breast cancer cells. [21]
Evidence Score (E-score) 1 +
1 ELISA; Western Blot [21]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Regulation Mechanism miR-223-KO exosomes contained higher level of STAT3 than WT-exosomes. [22]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [22]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-23a-3p miRNA Info
miRNA Mature AC
MIMAT0000078
Sequence aucacauugccagggauuucc
miRNA Species Homo sapiens
Regulation Mechanism STAT3 luciferase reporter activity was increased in the miR-23a inhibitor-transfected CNE2 cells, whereas reduced in the miR-23a mimic-transfected CNE2-IR cells. STAT3 signaling mediates miR-23a-regulated NPC cell radioresponse. [23]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [23]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
DNA topoisomerase I (TOP1) Target Info
TOP1_HUMAN
miRNA Mature ID hsa-miR-29b-1-5p miRNA Info
miRNA Mature AC
MIMAT0004514
Sequence gcugguuucauauggugguuuaga
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-29b partly inhibited the transcriptional activity of luciferase reporter containing mutant STAT3 3'UTR construct. [24]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [24]
Representative Target(s) Regulated by This miRNA Janus kinase 3 (JAK-3) Target Info
JAK3_HUMAN
Mothers against decapentaplegic homolog 3 (SMAD3) Target Info
SMAD3_HUMAN
miRNA Mature ID hsa-miR-340-5p miRNA Info
miRNA Mature AC
MIMAT0004692
Sequence uuauaaagcaaugagacugauu
miRNA Species Homo sapiens
Regulation Mechanism Downregulating miR-340-5p expression resulted in the increased protein level of STAT3. [25]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [25]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-519d-3p miRNA Info
miRNA Mature AC
MIMAT0002853
Sequence caaagugccucccuuuagagug
miRNA Species Homo sapiens
Regulation Mechanism STAT3 was a target gene of miR-519d. [26]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [26]
Representative Target(s) Regulated by This miRNA Calcium-release activated calcium channel (CRACM) Target Info
CRCM1_HUMAN
E2F transcription factor 1 (E2F1) Target Info
E2F1_HUMAN
miRNA Mature ID hsa-miR-520c-3p miRNA Info
miRNA Mature AC
MIMAT0002846
Sequence aaagugcuuccuuuuagagggu
miRNA Species Homo sapiens
Regulation Mechanism miR520c blocks EMT progression of human breast cancer cells by repressing STAT3. [27]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [27]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
miRNA Mature ID hsa-miR-1181 miRNA Info
miRNA Mature AC
MIMAT0005826
Sequence ccgucgccgccacccgagccg
miRNA Species Homo sapiens
Regulation Mechanism miR-1181 directly suppressed STAT3 expression, resulting in downregulation of SOX2 and inhibition of the STAT3 pathway. [28]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [28]
Representative Target(s) Regulated by This miRNA Signal transducer and activator of transcription 3 (STAT3) Target Info
STAT3_HUMAN
Transcription factor SOX-2 (SOX2) Target Info
SOX2_HUMAN
miRNA Mature ID hsa-miR-323a-3p miRNA Info
miRNA Mature AC
MIMAT0000755
Sequence cacauuacacggucgaccucu
miRNA Species Homo sapiens
Regulation Mechanism Transfection with miR-323-3p mimics downregulated the expression of STAT3. [29]
Evidence Score (E-score) 1 +
1 qRT-PCR [29]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1B p27Kip1 (CDKN1B) Target Info
CDN1B_HUMAN
Mothers against decapentaplegic homolog 3 (SMAD3) Target Info
SMAD3_HUMAN
miRNA Mature ID hsa-miR-337-3p miRNA Info
miRNA Mature AC
MIMAT0000754
Sequence cuccuauaugaugccuuucuuc
miRNA Species Homo sapiens
Regulation Mechanism STAT3 is a direct target of miR-337-3p. [30]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [30]
Representative Target(s) Regulated by This miRNA Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
Signal transducer and activator of transcription 3 (STAT3) Target Info
STAT3_HUMAN
miRNA Mature ID hsa-miR-544a miRNA Info
miRNA Mature AC
MIMAT0003164
Sequence auucugcauuuuuagcaaguuc
miRNA Species Homo sapiens
Regulation Mechanism miR-544 directly targeted the 3'untranslated region (UTR) on STAT3 mRNA, and overexpression of miR-544 down regulated expressions of STAT3, which in turn severely inhibited cancer cell proliferation, migration and invasion in vitro. [31]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [31]
Representative Target(s) Regulated by This miRNA Epithelial cadherin (CDH1) Target Info
CADH1_HUMAN
Polycomb complex protein BMI-1 (BMI1) Target Info
BMI1_HUMAN
miRNA Mature ID hsa-miR-874-3p miRNA Info
miRNA Mature AC
MIMAT0004911
Sequence cugcccuggcccgagggaccga
miRNA Species Homo sapiens
Regulation Mechanism Downregulation of miR-874 contributes to tumor angiogenesis through STAT3 in gastric cancer highlighting the potential of miR-874 as a target for human gastric cancer therapy. [32]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [32]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 9 (CDK9) Target Info
CDK9_HUMAN
Histone deacetylase 1 (HDAC1) Target Info
HDAC1_HUMAN
miRNA Mature ID hsa-miR-1234-3p miRNA Info
miRNA Mature AC
MIMAT0005589
Sequence ucggccugaccacccaccccac
miRNA Species Homo sapiens
Regulation Mechanism STAT3 protein was downregulated in cells transfected with miR-1234, suggesting that STAT3 might be a potential target for miR-1234. [33]
Evidence Score (E-score) 1 +
1 Western Blot [33]
Representative Target(s) Regulated by This miRNA Signal transducer and activator of transcription 3 (STAT3) Target Info
STAT3_HUMAN
miRNA Mature ID hsa-miR-410-5p miRNA Info
miRNA Mature AC
MIMAT0026558
Sequence agguugucugugaugaguucg
miRNA Species Homo sapiens
Regulation Mechanism miRNA-410 targets STAT3. [34]
Evidence Score (E-score) 1 +
1 ELISA; Luciferase Reporter Assay; Western Blot [34]
Representative Target(s) Regulated by This miRNA Signal transducer and activator of transcription 3 (STAT3) Target Info
STAT3_HUMAN
miRNA Mature ID hsa-miR-4516 miRNA Info
miRNA Mature AC
MIMAT0019053
Sequence gggagaagggucggggc
miRNA Species Homo sapiens
Regulation Mechanism hsa-miR-4516 directly targets STAT3 protein by binding to its 3'UTR in HaCaT cells. [35]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [35]
Representative Target(s) Regulated by This miRNA Signal transducer and activator of transcription 3 (STAT3) Target Info
STAT3_HUMAN
References  Top
REF 1 Regulation of STAT3 by miR-106a is linked to cognitive impairment in ovariectomized mice. Brain Res. 2013 Mar 29;1503:43-52.
REF 2 EMMPRIN Down-regulating miR-106a/b Modifies Breast Cancer Stem-like Cell Properties via Interaction with Fibroblasts Through STAT3 and HIF-1. Sci Rep. 2016 Jun 21;6:28329.
REF 3 MiRNA-20 and mirna-106a regulate spermatogonial stem cell renewal at the post-transcriptional level via targeting STAT3 and Ccnd1. Stem Cells. 2013 Oct;31(10):2205-17.
REF 4 miRNA-21 inhibition enhances RANTES and IP-10 release in MCF-7 via PIAS3 and STAT3 signalling and causes increased lymphocyte migration. Biochem Biophys Res Commun. 2013 Sep 27;439(3):384-9.
REF 5 miR-21: A gene of dual regulation in breast cancer. Int J Oncol. 2016 Jan;48(1):161-72.
REF 6 Downregulation of miR-21 inhibits EGFR pathway and suppresses the growth of human glioblastoma cells independent of PTEN status. Lab Invest. 2010 Feb;90(2):144-55.
REF 7 MiR-106b exhibits an anti-angiogenic function by inhibiting STAT3 expression in endothelial cells. Lipids Health Dis. 2016 Mar 9;15:51.
REF 8 A MDM2-dependent positive-feedback loop is involved in inhibition of miR-375 and miR-106b induced by Helicobacter pylori lipopolysaccharide. Int J Cancer. 2015 May 1;136(9):2120-31.
REF 9 MiR-130b is a prognostic marker and inhibits cell proliferation and invasion in pancreatic cancer through targeting STAT3. PLoS One. 2013 Sep 10;8(9):e73803.
REF 10 Intravenous injection of microvesicle-delivery miR-130b alleviates high-fat diet-induced obesity in C57BL/6 mice through translational repression of PPAR-. J Biomed Sci. 2015 Oct 16;22:86.
REF 11 MicroRNA-148a suppresses proliferation and invasion potential of non-small cell lung carcinomas via regulation of STAT3. Onco Targets Ther. 2017 Mar 2;10:1353-1361.
REF 12 miR-148a suppresses autophagy by down-regulation of IL-6/STAT3 signaling in cerulein-induced acute pancreatitis. Pancreatology. 2019 Jun;19(4):557-565.
REF 13 MicroRNA-17 inhibits tumor growth by stimulating T-cell mediated host immune response. Oncoscience. 2014 Jul 27;1(7):531-9.
REF 14 HIF-1 downregulates miR-17/20a directly targeting p21 and STAT3: a role in myeloid leukemic cell differentiation. Cell Death Differ. 2013 Mar;20(3):408-18.
REF 15 MicroRNA-29a promotes apoptosis of monocytes by targeting STAT3 during sepsis. Genet Mol Res. 2015 Oct 29;14(4):13746-53.
REF 16 miR-20b suppresses Th17 differentiation and the pathogenesis of experimental autoimmune encephalomyelitis by targeting RORt and STAT3. J Immunol. 2014 Jun 15;192(12):5599-609.
REF 17 Effects of microRNA-21 on the biological functions of T-cell acute lymphoblastic lymphoma/leukemia. Oncol Lett. 2016 Nov;12(5):4173-4180.
REF 18 STAT3 signaling stimulates miR-21 expression in bovine cumulus cells during in vitro oocyte maturation. Sci Rep. 2018 Aug 1;8(1):11527.
REF 19 Anti-inflammatory role of microRNA let-7c in LPS treated alveolar macrophages by targeting STAT3. Asian Pac J Trop Med. 2016 Jan;9(1):72-5.
REF 20 MiR-125a suppresses tumor growth, invasion and metastasis in cervical cancer by targeting STAT3. Oncotarget. 2015 Sep 22;6(28):25266-80.
REF 21 miR-20b modulates VEGF expression by targeting HIF-1 alpha and STAT3 in MCF-7 breast cancer cells. J Cell Physiol. 2010 Jul;224(1):242-9.
REF 22 Exosomal miR-223 Contributes to Mesenchymal Stem Cell-Elicited Cardioprotection in Polymicrobial Sepsis. Sci Rep. 2015 Sep 8;5:13721.
REF 23 MiR-23a sensitizes nasopharyngeal carcinoma to irradiation by targeting IL-8/Stat3 pathway. Oncotarget. 2015 Sep 29;6(29):28341-56.
REF 24 Chemotherapy-mediated miR-29b expression inhibits the invasion and angiogenesis of cervical cancer. Oncotarget. 2017 Feb 28;8(9):14655-14665.
REF 25 Hepatitis B virus promotes cancer cell migration by downregulating miR-340-5p expression to induce STAT3 overexpression. Cell Biosci. 2017 Apr 12;7:16.
REF 26 miR-519d-mediated downregulation of STAT3 suppresses breast cancer progression. Oncol Rep. 2015 Oct;34(4):2188-94.
REF 27 miR520c blocks EMT progression of human breast cancer cells by repressing STAT3. Oncol Rep. 2017 Mar;37(3):1537-1544.
REF 28 MiR-1181 inhibits stem cell-like phenotypes and suppresses SOX2 and STAT3 in human pancreatic cancer. Cancer Lett. 2015 Jan 28;356(2 Pt B):962-70.
REF 29 Increased microRNA-323-3p in IL-22/IL-17-producing T cells and asthma: a role in the regulation of the TGF- pathway and IL-22 production. Allergy. 2017 Jan;72(1):55-65.
REF 30 miR-337-3p and its targets STAT3 and RAP1A modulate taxane sensitivity in non-small cell lung cancers. PLoS One. 2012;7(6):e39167.
REF 31 MicroRNA-544 down-regulates both Bcl6 and Stat3 to inhibit tumor growth of human triple negative breast cancer. Biol Chem. 2016 Oct 1;397(10):1087-95.
REF 32 miR-874 functions as a tumor suppressor by inhibiting angiogenesis through STAT3/VEGF-A pathway in gastric cancer. Oncotarget. 2015 Jan 30;6(3):1605-17.
REF 33 Expression of microRNA-1234 related signal transducer and activator of transcription 3 in patients with diffuse large B-cell lymphoma of activated B-cell like type from high and low infectious disease areas. Leuk Lymphoma. 2014 May;55(5):1158-65.
REF 34 MiR-410 Down-Regulates the Expression of Interleukin-10 by Targeting STAT3 in the Pathogenesis of Systemic Lupus Erythematosus. Cell Physiol Biochem. 2016;39(1):303-15.
REF 35 hsa-miR-4516 mediated downregulation of STAT3/CDK6/UBE2N plays a role in PUVA induced apoptosis in keratinocytes. J Cell Physiol. 2014 Nov;229(11):1630-8.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.