miRNA General Information
miRNA Mature ID	hsa-miR-410-5p
miRNA Stemloop AC	MI0002465
miRNA Stemloop ID	hsa-mir-410
Sequence	agguugucugugaugaguucg
TTD Target(s) Regulated by This miRNA	Signal transducer and activator of transcription 3 (STAT3)	Successful Target	Target Info	[1]
References
REF 1	MiR-410 Down-Regulates the Expression of Interleukin-10 by Targeting STAT3 in the Pathogenesis of Systemic Lupus Erythematosus. Cell Physiol Biochem. 2016;39(1):303-15.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.