miRNA General Information
miRNA Mature ID hsa-miR-1181
miRNA Stemloop AC MI0006274
miRNA Stemloop ID hsa-mir-1181
Sequence ccgucgccgccacccgagccg
TTD Target(s) Regulated by This miRNA Signal transducer and activator of transcription 3 (STAT3) Successful Target Target Info [1]
Transcription factor SOX-2 (SOX2) Literature-reported Target Target Info [1]
References
REF 1 MiR-1181 inhibits stem cell-like phenotypes and suppresses SOX2 and STAT3 in human pancreatic cancer. Cancer Lett. 2015 Jan 28;356(2 Pt B):962-70.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.