miRNA General Information
miRNA Mature ID	hsa-miR-1234-3p
miRNA Stemloop AC	MI0006324
miRNA Stemloop ID	hsa-mir-1234
Sequence	ucggccugaccacccaccccac
TTD Target(s) Regulated by This miRNA	Signal transducer and activator of transcription 3 (STAT3)	Successful Target	Target Info	[1]
References
REF 1	Expression of microRNA-1234 related signal transducer and activator of transcription 3 in patients with diffuse large B-cell lymphoma of activated B-cell like type from high and low infectious disease areas. Leuk Lymphoma. 2014 May;55(5):1158-65.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.