Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T49989 Target Info
Target Name TGF-beta receptor type II (TGFBR2)
Synonyms Transforminggrowth factor-beta receptor type II; Transforming growth factor-beta receptor type II; TbetaR-II; TGFR-2; TGF-beta type II receptor; TGF-beta receptor type-2
Target Type Clinical trial Target
Gene Name TGFBR2
Biochemical Class Kinase
UniProt ID
P37173
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 7 +
1 Immunoblot; Immunofluorescence; Luciferase Reporter Assay; qRT-PCR [1]
2 Immunoblot; Immunohistochemistry; In Situ Hybridization; Luciferase Reporter Assay; qRT-PCR [2]
3 Immunoblot; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay [4]
5 Luciferase Reporter Assay; Microarray; Reporter Assay [5]
6 Microarray; qRT-PCR [6]
7 PAR-CLIP [7]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-21-5p miRNA Info
miRNA Mature AC
MIMAT0000076
Sequence uagcuuaucagacugauguuga
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-21-5p by mature miRNA precursor transfection resulted in the decreased protein level of target TGFBR2. [5]
Evidence Score (E-score) 7 +
1 Immunofluorescence; Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
2 Immunofluorescent Assay; Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
3 Luciferase Reporter Assay [9]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [10]
5 Luciferase Reporter Assay; Western Blot [11]
6 qRT-PCR; Luciferase Reporter Assay; Western Blot [12]
7 qRT-PCR; Western Blot [13]
Representative Target(s) Regulated by This miRNA Apoptosis antigen ligand (CD178) Target Info
TNFL6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-19a-3p miRNA Info
miRNA Mature AC
MIMAT0000073
Sequence ugugcaaaucuaugcaaaacuga
miRNA Species Homo sapiens
Evidence Score (E-score) 6 +
1 Luciferase Reporter Assay [14]
2 Luciferase Reporter Assay [4]
3 Luciferase Reporter Assay [15]
4 Luciferase Reporter Assay [16]
5 Luciferase Reporter Assay; Microarray [3]
6 qRT-PCR; Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Adrenergic receptor beta-1 (ADRB1) Target Info
ADRB1_HUMAN
Apoptosis signal-regulating kinase 1 (MAP3K5) Target Info
M3K5_HUMAN
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 5 +
1 Immunoblot; Immunohistochemistry; In Situ Hybridization; Luciferase Reporter Assay; qRT-PCR [2]
2 Immunoblot; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [3]
3 Luciferase Reporter Assay; Immunohistochemistry; qRT-PCR; Western Blot [18]
4 PAR-CLIP [19]
5 qRT-PCR; Luciferase Reporter Assay; Western Blot [20]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Regulation Mechanism Tgfbr2 is a target of miR-145. [21]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [9]
2 Luciferase Reporter Assay; Western Blot [21]
3 qRT-PCR; Luciferase Reporter Assay; Immunoblot; Western Blot [22]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR [23]
2 PAR-CLIP [19]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-130a-3p miRNA Info
miRNA Mature AC
MIMAT0000425
Sequence cagugcaauguuaaaagggcau
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Immunohistochemistry; Luciferase Reporter Assay; qRT-PCR; Western Blot [24]
2 PAR-CLIP [19]
Representative Target(s) Regulated by This miRNA Activin receptor-like kinase 2 (ALK-2) Target Info
ACVR1_HUMAN
Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
miRNA Mature ID hsa-miR-142-5p miRNA Info
miRNA Mature AC
MIMAT0000433
Sequence cauaaaguagaaagcacuacu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [25]
2 PAR-CLIP [19]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-18a-5p miRNA Info
miRNA Mature AC
MIMAT0000072
Sequence uaaggugcaucuagugcagauag
miRNA Species Homo sapiens
Regulation Mechanism miR-18a-5p binds to the 3'UTR region of transforming growth factor b receptor II (TGF-bRII) mRNA, and this is associated with reduced TGF-bRII expression and suppression of TGF-b-Smad2/3 signaling. [26]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Microarray [3]
2 Luciferase Reporter Assay; Western Blot [26]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-34b-5p miRNA Info
miRNA Mature AC
MIMAT0000685
Sequence uaggcagugucauuagcugauug
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [27]
2 PAR-CLIP [28]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-372-3p miRNA Info
miRNA Mature AC
MIMAT0000724
Sequence aaagugcugcgacauuugagcgu
miRNA Species Homo sapiens
Regulation Mechanism TGFBR2 is directly targeted by miR-372. [30]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [29]
2 Luciferase Reporter Assay; Western Blot [30]
Representative Target(s) Regulated by This miRNA ATPase family AAA domain containing 2 (ATAD2) Target Info
ATAD2_HUMAN
B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
miRNA Mature ID hsa-miR-373-3p miRNA Info
miRNA Mature AC
MIMAT0000726
Sequence gaagugcuucgauuuuggggugu
miRNA Species Homo sapiens
Regulation Mechanism TGFBR2 is directly targeted by miR-373. [30]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [31]
2 Luciferase Reporter Assay; Western Blot [30]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Cell surface protein HB15 (CD83) Target Info
CD83_HUMAN
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 ELISA; Immunohistochemistry; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [32]
2 Sequencing; PAR-CLIP [19]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-181c-5p miRNA Info
miRNA Mature AC
MIMAT0000258
Sequence aacauucaaccugucggugagu
miRNA Species Homo sapiens
Regulation Mechanism miR-181c inhibited mRNA translation by interacting with the TGFBR2-3'UTR directly. [33]
Evidence Score (E-score) 1 +
1 Immunohistochemistry; Luciferase Reporter Assay; Western Blot [33]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-196b-5p miRNA Info
miRNA Mature AC
MIMAT0001080
Sequence uagguaguuuccuguuguuggg
miRNA Species Homo sapiens
Regulation Mechanism Decreasing miR-196b expression in human HK2 cells strongly activated TGF-bR2. [34]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [34]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism TGFBR2 is a direct target of miR-204. [35]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [35]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-211-5p miRNA Info
miRNA Mature AC
MIMAT0000268
Sequence uucccuuugucauccuucgccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [36]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Calcium-activated potassium channel KCa1.1 (KCNMA1) Target Info
KCMA1_HUMAN
miRNA Mature ID hsa-miR-302b-3p miRNA Info
miRNA Mature AC
MIMAT0000715
Sequence uaagugcuuccauguuuuaguag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [29]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Dihydrothymine dehydrogenase (DPYD) Target Info
DPYD_HUMAN
miRNA Mature ID hsa-miR-302d-3p miRNA Info
miRNA Mature AC
MIMAT0000718
Sequence uaagugcuuccauguuugagugu
miRNA Species Homo sapiens
Regulation Mechanism TGFBR2, which is a tumor suppressor, was confirmed as a target of miR302d in HCC cells. [37]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [37]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Erbb4 tyrosine kinase receptor (Erbb-4) Target Info
ERBB4_HUMAN
miRNA Mature ID hsa-miR-370-3p miRNA Info
miRNA Mature AC
MIMAT0000722
Sequence gccugcugggguggaaccuggu
miRNA Species Homo sapiens
Regulation Mechanism TGFb-R2 is a target of miR-370. [38]
Evidence Score (E-score) 1 +
1 GFP Reporter Assay; LacZ Reporter Assay; Luciferase Reporter Assay; Western Blot [38]
Representative Target(s) Regulated by This miRNA Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
Forkhead box protein M1 (FOXM1) Target Info
FOXM1_HUMAN
miRNA Mature ID hsa-miR-520a-3p miRNA Info
miRNA Mature AC
MIMAT0002834
Sequence aaagugcuucccuuuggacugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [39]
Representative Target(s) Regulated by This miRNA Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
miRNA Mature ID hsa-miR-590-5p miRNA Info
miRNA Mature AC
MIMAT0003258
Sequence gagcuuauucauaaaagugcag
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-590 results in post-transcriptional repression of TGF-bRII. [40]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [40]
Representative Target(s) Regulated by This miRNA Cyclic-AMP-dependent transcription factor ATF-3 (ATF3) Target Info
ATF3_HUMAN
Lectin-like oxidized LDL receptor (OLR1) Target Info
OLR1_HUMAN
miRNA Mature ID hsa-miR-202-5p miRNA Info
miRNA Mature AC
MIMAT0002810
Sequence uuccuaugcauauacuucuuug
miRNA Species Homo sapiens
Regulation Mechanism miR-202-5p directly targets TGFBR2 for RNA interference in pancreatic cancer. [41]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [41]
Representative Target(s) Regulated by This miRNA B-cell-activating factor (TNFSF13B) Target Info
TN13B_HUMAN
TGF-beta receptor type I (TGFBR1) Target Info
TGFR1_HUMAN
miRNA Mature ID hsa-miR-23b-5p miRNA Info
miRNA Mature AC
MIMAT0004587
Sequence uggguuccuggcaugcugauuu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [9]
Representative Target(s) Regulated by This miRNA Mothers against decapentaplegic homolog 3 (SMAD3) Target Info
SMAD3_HUMAN
TGF-beta receptor type II (TGFBR2) Target Info
TGFR2_HUMAN
miRNA Mature ID hsa-miR-26a-5p miRNA Info
miRNA Mature AC
MIMAT0000082
Sequence uucaaguaauccaggauaggcu
miRNA Species Homo sapiens
Regulation Mechanism The overexpression of miR-26a-5p by mature miRNA transfection resulted in the smaller luciferase activity of target TGFBR2. [5]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [5]
Representative Target(s) Regulated by This miRNA Enhancer of zeste homolog 2 (EZH2) Target Info
EZH2_HUMAN
TGF-beta receptor type II (TGFBR2) Target Info
TGFR2_HUMAN
miRNA Mature ID hsa-miR-655-3p miRNA Info
miRNA Mature AC
MIMAT0003331
Sequence auaauacaugguuaaccucuuu
miRNA Species Homo sapiens
Regulation Mechanism TGFBR2 is a novel direct target of miR-655. [42]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [42]
Representative Target(s) Regulated by This miRNA Mammalian disintegrin-metalloprotease (ADAM10) Target Info
ADA10_HUMAN
TGF-beta receptor type II (TGFBR2) Target Info
TGFR2_HUMAN
References  Top
REF 1 FGF2 inhibits endothelial-mesenchymal transition through microRNA-20a-mediated repression of canonical TGF- signaling. J Cell Sci. 2016 Feb 1;129(3):569-79.
REF 2 MicroRNA-17/20a impedes migration and invasion via TGF-/ITGB6 pathway in esophageal squamous cell carcinoma. Am J Cancer Res. 2016 Jul 1;6(7):1549-62.
REF 3 The myc-miR-17~92 axis blunts TGF{beta} signaling and production of multiple TGF{beta}-dependent antiangiogenic factors. Cancer Res. 2010 Oct 15;70(20):8233-46.
REF 4 MicroRNA-17~92 inhibits colorectal cancer progression by targeting angiogenesis. Cancer Lett. 2016 Jul 1;376(2):293-302.
REF 5 A microRNA expression signature of human solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A. 2006 Feb 14;103(7):2257-61.
REF 6 MicroRNA expression profiles in umbilical cord blood cell lineages. Stem Cells Dev. 2010 Jan;19(1):17-26.
REF 7 In-depth analysis of the interaction of HIV-1 with cellular microRNA biogenesis and effector mechanisms. MBio. 2013 Apr 16;4(2):e000193.
REF 8 Androgen receptor and microRNA-21 axis downregulates transforming growth factor beta receptor II (TGFBR2) expression in prostate cancer. Oncogene. 2014 Jul 31;33(31):4097-106.
REF 9 Umbilical Cord-Derived Mesenchymal Stem Cell-Derived Exosomal MicroRNAs Suppress Myofibroblast Differentiation by Inhibiting the Transforming Growth Factor-/SMAD2 Pathway During Wound Healing. Stem Cells Transl Med. 2016 Oct;5(10):1425-1439.
REF 10 MicroRNA-21 targets a network of key tumor-suppressive pathways in glioblastoma cells. Cancer Res. 2008 Oct 1;68(19):8164-72.
REF 11 MicroRNA-21 induces stemness by downregulating transforming growth factor beta receptor 2 (TGFR2) in colon cancer cells. Carcinogenesis. 2012 Jan;33(1):68-76.
REF 12 MiR-21 regulates adipogenic differentiation through the modulation of TGF-beta signaling in mesenchymal stem cells derived from human adipose tissue. Stem Cells. 2009 Dec;27(12):3093-102.
REF 13 microRNA 21: response to hormonal therapies and regulatory function in leiomyoma, transformed leiomyoma and leiomyosarcoma cells. Mol Hum Reprod. 2010 Mar;16(3):215-27.
REF 14 Autophagy inhibition of hsa-miR-19a-3p/19b-3p by targeting TGF- R II during TGF-1-induced fibrogenesis in human cardiac fibroblasts. Sci Rep. 2016 Apr 21;6:24747.
REF 15 Identification of a pan-cancer oncogenic microRNA superfamily anchored by a central core seed motif. Nat Commun. 2013;4:2730.
REF 16 MYCN-regulated microRNAs repress estrogen receptor-alpha (ESR1) expression and neuronal differentiation in human neuroblastoma. Proc Natl Acad Sci U S A. 2010 Jan 26;107(4):1553-8.
REF 17 MicroRNA-19a enhances proliferation of bronchial epithelial cells by targeting TGFR2 gene in severe asthma. Allergy. 2015 Feb;70(2):212-9.
REF 18 MiR-17-5p regulates cell proliferation and migration by targeting transforming growth factor- receptor 2 in gastric cancer. Oncotarget. 2016 May 31;7(22):33286-96.
REF 19 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 20 miR-17 inhibition enhances the formation of kidney cancer spheres with stem cell/ tumor initiating cell properties. Oncotarget. 2015 Mar 20;6(8):5567-81.
REF 21 Expression patterns and regulatory functions of microRNAs during the initiation of primordial follicle development in the neonatal mouse ovary. Biol Reprod. 2013 Nov 27;89(5):126.
REF 22 MicroRNA miR145 regulates TGFBR2 expression and matrix synthesis in vascular smooth muscle cells. Circ Res. 2015 Jan 2;116(1):23-34.
REF 23 Colorectal cancer migration and invasion initiated by microRNA-106a. PLoS One. 2012;7(8):e43452.
REF 24 Onco-miR-130 promotes cell proliferation and migration by targeting TGFR2 in gastric cancer. Oncotarget. 2016 Jul 12;7(28):44522-44533.
REF 25 Rotavirus-induced miR-142-5p elicits proviral milieu by targeting non-canonical transforming growth factor beta signalling and apoptosis in cells. Cell Microbiol. 2016 May;18(5):733-47.
REF 26 miR-18a-5p Inhibits Sub-pleural Pulmonary Fibrosis by Targeting TGF- Receptor II. Mol Ther. 2017 Mar 1;25(3):728-738.
REF 27 Modeling SNP mediated differential targeting of homologous 3'UTR by microRNA. RNA Biol. 2012 Mar;9(3):351-60.
REF 28 Genome-wide identification of microRNA targets in human ES cells reveals a role for miR-302 in modulating BMP response.Genes Dev. 2011 Oct 15;25(20):2173-86.
REF 29 Multiple targets of miR-302 and miR-372 promote reprogramming of human fibroblasts to induced pluripotent stem cells. Nat Biotechnol. 2011 May;29(5):443-8.
REF 30 -Catenin/LEF1 transactivates the microRNA-371-373 cluster that modulates the Wnt/-catenin-signaling pathway. Oncogene. 2012 Jun 14;31(24):2968-78.
REF 31 TR4 nuclear receptor increases prostate cancer invasion via decreasing the miR-373-3p expression to alter TGFR2/p-Smad3 signals. Oncotarget. 2015 Jun 20;6(17):15397-409.
REF 32 TGFR2 is a major target of miR-93 in nasopharyngeal carcinoma aggressiveness. Mol Cancer. 2014 Mar 8;13:51.
REF 33 MicroRNA-181c inhibits glioblastoma cell invasion, migration and mesenchymal transition by targeting TGF- pathway. Biochem Biophys Res Commun. 2016 Jan 22;469(4):1041-8.
REF 34 MicroRNA-196a/b Mitigate Renal Fibrosis by Targeting TGF- Receptor 2. J Am Soc Nephrol. 2016 Oct;27(10):3006-3021.
REF 35 MicroRNA-204/211 alters epithelial physiology. FASEB J. 2010 May;24(5):1552-71.
REF 36 New target genes of MITF-induced microRNA-211 contribute to melanoma cell invasion. PLoS One. 2013 Sep 5;8(9):e73473.
REF 37 MicroRNA-302d downregulates TGFBR2 expression and promotes hepatocellular carcinoma growth and invasion. Exp Ther Med. 2017 Feb;13(2):681-687.
REF 38 Overexpression of miR-370 and downregulation of its novel target TGF-RII contribute to the progression of gastric carcinoma. Oncogene. 2012 Jan 12;31(2):226-37.
REF 39 MicroRNA-520c inhibits glioma cell migration and invasion by the suppression of transforming growth factor- receptor type2. Oncol Rep. 2017 Mar;37(3):1691-1697.
REF 40 Downregulation of miR-133 and miR-590 contributes to nicotine-induced atrial remodelling in canines. Cardiovasc Res. 2009 Aug 1;83(3):465-72.
REF 41 miR-202 Diminishes TGF Receptors and Attenuates TGF1-Induced EMT in Pancreatic Cancer. Mol Cancer Res. 2017 Aug;15(8):1029-1039.
REF 42 miR-655 Is an EMT-suppressive microRNA targeting ZEB1 and TGFBR2. PLoS One. 2013 May 14;8(5):e62757.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.