miRNA Details
| miRNA General Information | |||||
|---|---|---|---|---|---|
| miRNA Mature ID | hsa-miR-655-3p | ||||
| miRNA Stemloop AC | MI0003677 | ||||
| miRNA Stemloop ID | hsa-mir-655 | ||||
| Sequence | auaauacaugguuaaccucuuu | ||||
| TTD Target(s) Regulated by This miRNA | Mammalian disintegrin-metalloprotease (ADAM10) | Clinical trial Target | Target Info | [1] | |
| TGF-beta receptor type II (TGFBR2) | Clinical trial Target | Target Info | [2] | ||
| Protein(s) Regulated by This miRNA | Membrane-associated guanylate kinase, WW and PDZ domain-containing protein 2 | Regulated Protein | [3] | ||
| Paired mesoderm homeobox protein 1 | Regulated Protein | [4] | |||
| Securin | Regulated Protein | [5] | |||
| Zinc finger E-box-binding homeobox 1 | Regulated Protein | [2] | |||
| References | |||||
| REF 1 | MicroRNA-655-3p functions as a tumor suppressor by regulating ADAM10 and -catenin pathway in Hepatocellular Carcinoma. J Exp Clin Cancer Res. 2016 Jun 4;35(1):89. | ||||
| REF 2 | miR-655 Is an EMT-suppressive microRNA targeting ZEB1 and TGFBR2. PLoS One. 2013 May 14;8(5):e62757. | ||||
| REF 3 | MiR-134/487b/655 cluster regulates TGF--induced epithelial-mesenchymal transition and drug resistance to gefitinib by targeting MAGI2 in lung adenocarcinoma cells.Mol Cancer Ther. 2014 Feb;13(2):444-53. | ||||
| REF 4 | miR-655 suppresses epithelial-to-mesenchymal transition by targeting Prrx1 in triple-negative breast cancer.J Cell Mol Med. 2016 May;20(5):864-73. | ||||
| REF 5 | Mir-655 up-regulation suppresses cell invasion by targeting pituitary tumor-transforming gene-1 in esophageal squamous cell carcinoma.J Transl Med. 2013 Dec 6;11:301. | ||||
| REF 6 | miR-655 Is an EMT-suppressive microRNA targeting ZEB1 and TGFBR2. PLoS One. 2013 May 14;8(5):e62757. | ||||
If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.