Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T55610 Target Info
Target Name Hypoxia-inducible factor 1 alpha (HIF-1A)
Synonyms bHLHe78; Transcription factor HIF-1; PASD8; PAS domain-containing protein 8; Member of PAS protein 1; MOP1; Hypoxia-inducible transcription factor (HIF)-1; Hypoxia-inducible factor 1-alpha; Hypoxia-inducible factor 1 A; Hypoxia inducible factor 1; HIF1-alpha; HIF1 alpha; HIF-1alpha; HIF-1-alpha; HIF-1 alpha; Class E basic helix-loop-helix protein 78; Basic-helix-loop-helix-PAS protein MOP1; ARNT-interacting protein; ARNT interacting protein
Target Type Clinical trial Target
Gene Name HIF1A
UniProt ID
Q16665
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-17-5p miRNA Info
miRNA Mature AC
MIMAT0000070
Sequence caaagugcuuacagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 HITS-CLIP [1]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-18a-5p miRNA Info
miRNA Mature AC
MIMAT0000072
Sequence uaaggugcaucuagugcagauag
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay [4]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
3 Sequencing [6]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-93-5p miRNA Info
miRNA Mature AC
MIMAT0000093
Sequence caaagugcuguucgugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 3 +
1 HITS-CLIP [1]
2 Immunocytochemistry; Next Generation Sequencing; qRT-PCR [7]
3 Microarray; qRT-PCR [8]
Representative Target(s) Regulated by This miRNA Angiogenin (ANG) Target Info
ANGI_HUMAN
ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
miRNA Mature ID hsa-miR-20b-5p miRNA Info
miRNA Mature AC
MIMAT0001413
Sequence caaagugcucauagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism HIF1A functions as a target for miR-20b in MCF-7 breast cancer cells. [9]
Evidence Score (E-score) 2 +
1 ELISA; Western Blot [9]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [10]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 2 (CDK2) Target Info
CDK2_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-106b-5p miRNA Info
miRNA Mature AC
MIMAT0000680
Sequence uaaagugcugacagugcagau
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 HITS-CLIP [1]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [11]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 qRT-PCR; Immunohistochemistry; Western Blot [12]
2 qRT-PCR; Immunohistochemistry; Western Blot [13]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-18b-5p miRNA Info
miRNA Mature AC
MIMAT0001412
Sequence uaaggugcaucuagugcaguuag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [14]
2 PAR-CLIP [15]
Representative Target(s) Regulated by This miRNA Connective tissue growth factor (CTGF) Target Info
CTGF_HUMAN
Estrogen receptor (ESR) Target Info
ESR1_HUMAN
miRNA Mature ID hsa-miR-20a-5p miRNA Info
miRNA Mature AC
MIMAT0000075
Sequence uaaagugcuuauagugcagguag
miRNA Species Homo sapiens
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
2 Luciferase Reporter Assay; Western Blot; Northern Blot [13]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-33a-5p miRNA Info
miRNA Mature AC
MIMAT0000091
Sequence gugcauuguaguugcauugca
miRNA Species Homo sapiens
Regulation Mechanism HIF-1a is the direct target gene of miR-33a. [6]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [16]
2 Sequencing [6]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
ATP-binding cassette transporter B11 (ABCB11) Target Info
ABCBB_HUMAN
miRNA Mature ID hsa-miR-106a-5p miRNA Info
miRNA Mature AC
MIMAT0000103
Sequence aaaagugcuuacagugcagguag
miRNA Species Homo sapiens
Regulation Mechanism miR-106a targets HIF1A by binding its mRNA. [11]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [11]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Regulation Mechanism P53-induced microRNA-107 inhibits HIF-1 and tumor angiogenesis. [17]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot; Northern Blot [17]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-142-5p miRNA Info
miRNA Mature AC
MIMAT0000433
Sequence cauaaaguagaaagcacuacu
miRNA Species Homo sapiens
Regulation Mechanism The miR-142-mediated repression of HIF-1A 3'UTR luciferase reporter activity could be abolished by mutating the putative miR-142 binding sequence in the HIF-1A 3'UTR. [18]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-145-5p miRNA Info
miRNA Mature AC
MIMAT0000437
Sequence guccaguuuucccaggaaucccu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Chromatin Immunoprecipitation [19]
Representative Target(s) Regulated by This miRNA A proliferation-inducing ligand (APRIL) Target Info
TNF13_HUMAN
Alkaline phosphatase (ALPPL2) Target Info
PPBN_HUMAN
miRNA Mature ID hsa-miR-186-5p miRNA Info
miRNA Mature AC
MIMAT0000456
Sequence caaagaauucuccuuuugggcu
miRNA Species Homo sapiens
Regulation Mechanism HIF-1A is a target of miR-186, and miR-186/HIF-1A axis has an antioncogenic role in gastric cancer. [20]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [20]
Representative Target(s) Regulated by This miRNA Casein kinase II alpha (CSNK2A1) Target Info
CSK21_HUMAN
Fibroblast growth factor-2 (FGF2) Target Info
FGF2_HUMAN
miRNA Mature ID hsa-miR-199b-5p miRNA Info
miRNA Mature AC
MIMAT0000263
Sequence cccaguguuuagacuaucuguuc
miRNA Species Homo sapiens
Regulation Mechanism Underexpressed microRNA-199b-5p targets Hypoxia-Inducible Factor-1a in hepatocellular carcinoma and predicts prognosis of hepatocellular carcinoma patients. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [21]
Representative Target(s) Regulated by This miRNA Epithelial discoidin domain receptor 1 (DDR1) Target Info
DDR1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-200c-5p miRNA Info
miRNA Mature AC
MIMAT0004657
Sequence cgucuuacccagcaguguuugg
miRNA Species Homo sapiens
Regulation Mechanism HIF1A levels were downregulated by reconstitution of miR-200c. [7]
Evidence Score (E-score) 1 +
1 qRT-PCR [7]
Representative Target(s) Regulated by This miRNA Cytochrome P450 1B1 (CYP1B1) Target Info
CP1B1_HUMAN
Epithelial cadherin (CDH1) Target Info
CADH1_HUMAN
miRNA Mature ID hsa-miR-210-3p miRNA Info
miRNA Mature AC
MIMAT0000267
Sequence cugugcgugugacagcggcuga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [22]
Representative Target(s) Regulated by This miRNA Activin receptor type IB (ACVR1B) Target Info
ACV1B_HUMAN
Autophagy-related protein 7 (ATG7) Target Info
ATG7_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot [23]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism HIF-1A directly binds to and promotes miR-27a transcription, indicating that HIF-1A regulates the MDR of gastric cancer via miR-27a. [24]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [24]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-338-3p miRNA Info
miRNA Mature AC
MIMAT0000763
Sequence uccagcaucagugauuuuguug
miRNA Species Homo sapiens
Regulation Mechanism miR-338-3p regulated the expression levels of HIF-1A. [25]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [25]
Representative Target(s) Regulated by This miRNA G1/S-specific cyclin-D1 (CCND1) Target Info
CCND1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-424-5p miRNA Info
miRNA Mature AC
MIMAT0001341
Sequence cagcagcaauucauguuuugaa
miRNA Species Homo sapiens
Regulation Mechanism Hypoxia differentially increased microRNA-424 (miR-424) levels in ECs. [26]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [26]
Representative Target(s) Regulated by This miRNA Checkpoint kinase-1 (CHK1) Target Info
CHK1_HUMAN
Cyclin D (CCND3) Target Info
CCND3_HUMAN
miRNA Mature ID hsa-miR-429 miRNA Info
miRNA Mature AC
MIMAT0001536
Sequence uaauacugucugguaaaaccgu
miRNA Species Homo sapiens
Regulation Mechanism miR-429 directly HIF1A by targeting its mRNA. [27]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [27]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
DNA [cytosine-5]-methyltransferase 1 (DNMT1) Target Info
DNMT1_HUMAN
miRNA Mature ID hsa-miR-433-3p miRNA Info
miRNA Mature AC
MIMAT0001627
Sequence aucaugaugggcuccucggugu
miRNA Species Homo sapiens
Regulation Mechanism In a luciferase reporter system, miR-433 down-regulates the luciferase activity of HIF-1A 3'UTR, and these effects are abolished by a mutation in the putative miR-433-binding site. [28]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [28]
Representative Target(s) Regulated by This miRNA cAMP-dependent chloride channel (CFTR) Target Info
CFTR_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-519c-3p miRNA Info
miRNA Mature AC
MIMAT0002832
Sequence aaagugcaucuuuuuagaggau
miRNA Species Homo sapiens
Regulation Mechanism miR-519c Suppresses Hypoxia-Inducible Factor-1A Expression and Tumor Angiogenesis. [29]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [29]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter G2 (ABCG2) Target Info
ABCG2_HUMAN
ELAV-like protein 1 (ELAVL1) Target Info
ELAV1_HUMAN
miRNA Mature ID hsa-miR-138-1-3p miRNA Info
miRNA Mature AC
MIMAT0004607
Sequence gcuacuucacaacaccagggcc
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [30]
Representative Target(s) Regulated by This miRNA Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
Pyruvate dehydrogenase kinase 1 (PDHK1) Target Info
PDK1_HUMAN
miRNA Mature ID hsa-miR-497-3p miRNA Info
miRNA Mature AC
MIMAT0004768
Sequence caaaccacacugugguguuaga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Western Blot; Immunohistochemistry [31]
Representative Target(s) Regulated by This miRNA Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
References  Top
REF 1 EBV and human microRNAs co-target oncogenic and apoptotic viral and human genes during latency. EMBO J. 2012 May 2;31(9):2207-21.
REF 2 The natural inhibitor of DNA topoisomerase I, camptothecin, modulates HIF-1 activity by changing miR expression patterns in human cancer cells. Mol Cancer Ther. 2014 Jan;13(1):239-48.
REF 3 Regulation of the Hif-system by micro-RNA 17 and 20a - role during monocyte-to-macrophage differentiation. Mol Immunol. 2013 Dec;56(4):442-51.
REF 4 MicroRNA-17~92 inhibits colorectal cancer progression by targeting angiogenesis. Cancer Lett. 2016 Jul 1;376(2):293-302.
REF 5 microRNA-18a regulates gastric carcinoma cell apoptosis and invasion by suppressing hypoxia-inducible factor-1 expression. Exp Ther Med. 2015 Aug;10(2):717-722.
REF 6 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 7 Identification of Dormancy-Associated MicroRNAs for the Design of Osteosarcoma-Targeted Dendritic Polyglycerol Nanopolyplexes. ACS Nano. 2016 Feb 23;10(2):2028-45.
REF 8 MicroRNA profiling in mucosal biopsies of eosinophilic esophagitis patients pre and post treatment with steroids and relationship with mRNA targets. PLoS One. 2012;7(7):e40676.
REF 9 miR-20b modulates VEGF expression by targeting HIF-1 alpha and STAT3 in MCF-7 breast cancer cells. J Cell Physiol. 2010 Jul;224(1):242-9.
REF 10 Clinicopathological Significance of MicroRNA-20b Expression in Hepatocellular Carcinoma and Regulation of HIF-1 and VEGF Effect on Cell Biological Behaviour. Dis Markers. 2015;2015:325176.
REF 11 EMMPRIN Down-regulating miR-106a/b Modifies Breast Cancer Stem-like Cell Properties via Interaction with Fibroblasts Through STAT3 and HIF-1. Sci Rep. 2016 Jun 21;6:28329.
REF 12 MicroRNA-155 deficiency enhances the recruitment and functions of myeloid-derived suppressor cells in tumor microenvironment and promotes solid tumor growth. Int J Cancer. 2015 Mar 15;136(6):E602-13.
REF 13 Identification of hypoxia-inducible factor-1 alpha as a novel target for miR-17-92 microRNA cluster. Cancer Res. 2008 Jul 15;68(14):5540-5.
REF 14 MicroRNA-18b inhibits the growth of malignant melanoma via inhibition of HIF-1-mediated glycolysis. Oncol Rep. 2016 Jul;36(1):471-9.
REF 15 A quantitative analysis of CLIP methods for identifying binding sites of RNA-binding proteins. Nat Methods. 2011 May 15;8(7):559-64.
REF 16 miR-33a functions as a tumor suppressor in melanoma by targeting HIF-1. Cancer Biol Ther. 2015;16(6):846-55.
REF 17 P53-induced microRNA-107 inhibits HIF-1 and tumor angiogenesis. Proc Natl Acad Sci U S A. 2010 Apr 6;107(14):6334-9.
REF 18 MiR-142 modulates human pancreatic cancer proliferation and invasion by targeting hypoxia-inducible factor 1 (HIF-1) in the tumor microenvironments. Biol Open. 2017 Feb 15;6(2):252-259.
REF 19 Identification of a hypoxia-regulated miRNA signature in bladder cancer and a role for miR-145 in hypoxia-dependent apoptosis. Br J Cancer. 2015 Aug 11;113(4):634-44.
REF 20 MiR-186 inhibited aerobic glycolysis in gastric cancer via HIF-1 regulation. Oncogenesis. 2016 May 9;5:e224.
REF 21 Underexpressed microRNA-199b-5p targets hypoxia-inducible factor-1 in hepatocellular carcinoma and predicts prognosis of hepatocellular carcinoma patients. J Gastroenterol Hepatol. 2011 Nov;26(11):1630-7.
REF 22 Effects of knockdown of miR-210 in combination with ionizing radiation on human hepatoma xenograft in nude mice. Radiat Oncol. 2013 Apr 25;8:102.
REF 23 Galectin-1 has potential prognostic significance and is implicated in clear cell renal cell carcinoma progression through the HIF/mTOR signaling axis. Br J Cancer. 2014 Mar 4;110(5):1250-9.
REF 24 HIF-1 Induces Multidrug Resistance in Gastric Cancer Cells by Inducing MiR-27a. PLoS One. 2015 Aug 20;10(8):e0132746.
REF 25 MicroRNA-338 inhibits migration and proliferation by targeting hypoxia-induced factor 1 in nasopharyngeal carcinoma. Oncol Rep. 2015 Oct;34(4):1943-52.
REF 26 Hypoxia-induced microRNA-424 expression in human endothelial cells regulates HIF- isoforms and promotes angiogenesis. J Clin Invest. 2010 Nov;120(11):4141-54.
REF 27 The hypoxia-inducible miR-429 regulates hypoxia-inducible factor-1 expression in human endothelial cells through a negative feedback loop. FASEB J. 2015 Apr;29(4):1467-79.
REF 28 MicroRNA-433 Inhibits the Proliferation and Migration of HUVECs and Neurons by Targeting Hypoxia-Inducible Factor 1 Alpha. J Mol Neurosci. 2017 Feb;61(2):135-143.
REF 29 MicroRNA-519c suppresses hypoxia-inducible factor-1alpha expression and tumor angiogenesis. Cancer Res. 2010 Apr 1;70(7):2675-85.
REF 30 MicroRNA-138 suppresses proliferation, invasion and glycolysis in malignant melanoma cells by targeting HIF-1. Exp Ther Med. 2016 Jun;11(6):2513-2518.
REF 31 miR-497 suppresses angiogenesis in breast carcinoma by targeting HIF-1. Oncol Rep. 2016 Mar;35(3):1696-702.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.