Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T21705 Target Info
Target Name F-box and WD-40 domain protein 7 (Fbxw7)
Synonyms hCdc4; hAgo; SEL10; SEL-10; FBX30; FBW7; F-box/WD repeat-containing protein 7; F-box-WD40 repeat protein 6; F-box protein Fbxw6; F-box protein FBX30; F-box protein FBW7; F-box and WD-40 domain-containing protein 7; Archipelago homolog
Target Type Literature-reported Target
Gene Name FBXW7
UniProt ID
Q969H0
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-223-3p miRNA Info
miRNA Mature AC
MIMAT0000280
Sequence ugucaguuugucaaauacccca
miRNA Species Homo sapiens
Regulation Mechanism miR-223 directly targets FBXW7. [4]
Evidence Score (E-score) 5 +
1 Luciferase Reporter Assay [1]
2 Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [2]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [3]
4 Luciferase Reporter Assay; Western Blot [4]
5 qRT-PCR; Western Blot [5]
Representative Target(s) Regulated by This miRNA ATM serine/threonine kinase (ATM) Target Info
ATM_HUMAN
C-X-C motif chemokine 2 (CXCL2) Target Info
CXCL2_HUMAN
miRNA Mature ID hsa-miR-25-3p miRNA Info
miRNA Mature AC
MIMAT0000081
Sequence cauugcacuugucucggucuga
miRNA Species Homo sapiens
Regulation Mechanism miR-25 directly regulates FBXW7 expression through the miRNA binding site in its 3'UTR. [8]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
2 Luciferase Reporter Assay; Western Blot [7]
3 Western Blot; Immunofluorescence; Immunohistochemistry [8]
Representative Target(s) Regulated by This miRNA CDK inhibitor 1C p57Kip2 (CDKN1C) Target Info
CDN1C_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-27a-3p miRNA Info
miRNA Mature AC
MIMAT0000084
Sequence uucacaguggcuaaguuccgc
miRNA Species Homo sapiens
Regulation Mechanism The Fbxw7 gene is a direct target of miR-27a. [11]
Evidence Score (E-score) 3 +
1 Luciferase Reporter Assay; Western Blot [9]
2 Luciferase Reporter Assay; Western Blot [10]
3 Sequencing [11]
Representative Target(s) Regulated by This miRNA ATP-binding cassette transporter A1 (ABCA1) Target Info
ABCA1_HUMAN
Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
miRNA Mature ID hsa-miR-155-3p miRNA Info
miRNA Mature AC
MIMAT0004658
Sequence cuccuacauauuagcauuaaca
miRNA Species Homo sapiens
Regulation Mechanism Overexpression of miR-155-3p is correlated with decreased levels FBXW7 mainly through inhibiting the expression of FBXW7. [12]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [12]
2 Western Blot [13]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-182-3p miRNA Info
miRNA Mature AC
MIMAT0000260
Sequence ugguucuagacuugccaacua
miRNA Species Homo sapiens
Regulation Mechanism E3 ubiquitin-protein ligase FBXW7 is a target gene of miR-182. [14]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay; Western Blot [14]
2 Western Blot [15]
Representative Target(s) Regulated by This miRNA F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
NADPH oxidase 4 (NOX4) Target Info
NOX4_HUMAN
miRNA Mature ID hsa-miR-107 miRNA Info
miRNA Mature AC
MIMAT0000104
Sequence agcagcauuguacagggcuauca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Northern Blot; Western Blot [16]
Representative Target(s) Regulated by This miRNA Beta-secretase 1 (BACE1) Target Info
BACE1_HUMAN
Caveolin 1 (CAV1) Target Info
CAV1_HUMAN
miRNA Mature ID hsa-miR-155-5p miRNA Info
miRNA Mature AC
MIMAT0000646
Sequence uuaaugcuaaucgugauagggguu
miRNA Species Homo sapiens
Regulation Mechanism FBXW7 mRNA was the functional target of miR-155. [13]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [13]
Representative Target(s) Regulated by This miRNA Acetyl-CoA transporter (SLC33A1) Target Info
ACATN_HUMAN
Angiotensin II receptor type-1 (AGTR1) Target Info
AGTR1_HUMAN
miRNA Mature ID hsa-miR-182-5p miRNA Info
miRNA Mature AC
MIMAT0000259
Sequence uuuggcaaugguagaacucacacu
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
miRNA Mature ID hsa-miR-32-5p miRNA Info
miRNA Mature AC
MIMAT0000090
Sequence uauugcacauuacuaaguugca
miRNA Species Homo sapiens
Regulation Mechanism miR-32 binds to the 3'UTR of FBXW7, suggesting that FBXW7 is a direct target of miR-32. [18]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [18]
Representative Target(s) Regulated by This miRNA Aurora kinase A (AURKA) Target Info
AURKA_HUMAN
F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
miRNA Mature ID hsa-miR-363-3p miRNA Info
miRNA Mature AC
MIMAT0000707
Sequence aauugcacgguauccaucugua
miRNA Species Homo sapiens
Regulation Mechanism Increased miR-363 expression promotes gastric cancer cell proliferation and chemo-resistance through directly targeting the tumor suppressor F-box and WD repeat domain-containing 7 (FBXW7). [19]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [19]
Representative Target(s) Regulated by This miRNA Caspase-3 (CASP3) Target Info
CASP3_HUMAN
Cyclic AMP-responsive element-binding protein (CREB1) Target Info
CREB1_HUMAN
miRNA Mature ID hsa-miR-503-5p miRNA Info
miRNA Mature AC
MIMAT0002874
Sequence uagcagcgggaacaguucugcag
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [17]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
CD40L receptor (CD40) Target Info
TNR5_HUMAN
miRNA Mature ID hsa-miR-223-5p miRNA Info
miRNA Mature AC
MIMAT0004570
Sequence cguguauuugacaagcugaguu
miRNA Species Homo sapiens
Regulation Mechanism miR-223 targeted FBW7 and miR-223/FBW7 regulated cellular phenotype and chemosensitivity in NSCLC cells. [20]
Evidence Score (E-score) 1 +
1 qRT-PCR; Western Blot [20]
Representative Target(s) Regulated by This miRNA Epidermal growth factor (EGF) Target Info
EGF_HUMAN
F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
miRNA Mature ID hsa-miR-367-3p miRNA Info
miRNA Mature AC
MIMAT0000719
Sequence aauugcacuuuagcaaugguga
miRNA Species Homo sapiens
Regulation Mechanism miR-367 is a negative regulator of FBXW7 in NSCLC and miR-367 modulates FBXW7 expression by directly targeting its 3'UTR. [21]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [21]
Representative Target(s) Regulated by This miRNA F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
Kruppel like factor 4 (KLF4) Target Info
KLF4_HUMAN
miRNA Mature ID hsa-miR-384 miRNA Info
miRNA Mature AC
MIMAT0001075
Sequence auuccuagaaauuguucaua
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [22]
Representative Target(s) Regulated by This miRNA Endoplasmic reticulum chaperone BiP (HSPA5) Target Info
BIP_HUMAN
F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
miRNA Mature ID hsa-miR-770-5p miRNA Info
miRNA Mature AC
MIMAT0003948
Sequence uccaguaccacgugucagggcca
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [23]
Representative Target(s) Regulated by This miRNA F-box and WD-40 domain protein 7 (Fbxw7) Target Info
FBXW7_HUMAN
References  Top
REF 1 Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression. PLoS One. 2013 Dec 4;8(12):e82167.
REF 2 The sensitivity of gastric cancer to trastuzumab is regulated by the miR-223/FBXW7 pathway. Int J Cancer. 2015 Apr 1;136(7):1537-45.
REF 3 MiR-223 promotes the cisplatin resistance of human gastric cancer cells via regulating cell cycle by targeting FBXW7. J Exp Clin Cancer Res. 2015 Mar 26;34:28.
REF 4 MicroRNA-223 functions as an oncogene in human gastric cancer by targeting FBXW7/hCdc4. J Cancer Res Clin Oncol. 2012 May;138(5):763-74.
REF 5 miR 23 p regulates cell growth and apoptosis via FBXW7 suggesting an oncogenic role in human testicular germ cell tumors. Int J Oncol. 2017 Feb;50(2):356-364.
REF 6 MicroRNA-25 promotes gastric cancer proliferation, invasion, and migration by directly targeting F-box and WD-40 Domain Protein 7, FBXW7. Tumour Biol. 2015 Sep;36(10):7831-40.
REF 7 MiR-25 is up-regulated in non-small cell lung cancer and promotes cell proliferation and motility by targeting FBXW7. Int J Clin Exp Pathol. 2015 Aug 1;8(8):9147-53.
REF 8 p53 Mutation Directs AURKA Overexpression via miR-25 and FBXW7 in Prostatic Small Cell Neuroendocrine Carcinoma. Mol Cancer Res. 2015 Mar;13(3):584-91.
REF 9 MiR-27a-3p promotes esophageal cancer cell proliferation via F-box and WD repeat domain-containing 7 (FBXW7) suppression. Int J Clin Exp Med. 2015 Sep 15;8(9):15556-62.
REF 10 Upregulation of miR-27a contributes to the malignant transformation of human bronchial epithelial cells induced by SV40 small T antigen. Oncogene. 2011 Sep 8;30(36):3875-86.
REF 11 Transcriptome-wide identification of RNA-binding protein and microRNA target sites by PAR-CLIP. Cell. 2010 Apr 2;141(1):129-41.
REF 12 MicroRNA-155-3p promotes hepatocellular carcinoma formation by suppressing FBXW7 expression. J Exp Clin Cancer Res. 2016 Jun 16;35(1):93.
REF 13 Tumor-suppressive function of long noncoding RNA MALAT1 in glioma cells by suppressing miR-155 expression and activating FBXW7 function. Am J Cancer Res. 2016 Nov 1;6(11):2561-2574.
REF 14 MiR-182 promotes proliferation and invasion and elevates the HIF-1-VEGF-A axis in breast cancer cells by targeting FBXW7. Am J Cancer Res. 2016 Aug 1;6(8):1785-98.
REF 15 MiR-182 promotes cell proliferation by suppressing FBXW7 and FBXW11 in non-small cell lung cancer. Am J Transl Res. 2018 Apr 15;10(4):1131-1142.
REF 16 Anti-Argonaute RIP-Chip shows that miRNA transfections alter global patterns of mRNA recruitment to microribonucleoprotein complexes. RNA. 2010 Feb;16(2):394-404.
REF 17 Sequential expression of miR-182 and miR-503 cooperatively targets FBXW7, contributing to the malignant transformation of colon adenoma to adenocarcinoma. J Pathol. 2014 Dec;234(4):488-501.
REF 18 MicroRNA-32 promotes cell proliferation, migration and suppresses apoptosis in breast cancer cells by targeting FBXW7. Cancer Cell Int. 2017 Jan 25;17:14.
REF 19 miR-363 promotes proliferation and chemo-resistance of human gastric cancer via targeting of FBW7 ubiquitin ligase expression. Oncotarget. 2016 Jun 7;7(23):35284-92.
REF 20 miR-223/FBW7 axis regulates doxorubicin sensitivity through epithelial mesenchymal transition in non-small cell lung cancer. Am J Transl Res. 2016 Jun 15;8(6):2512-24.
REF 21 miR-367 promotes the proliferation and invasion of non-small cell lung cancer via targeting FBXW7. Oncol Rep. 2017 Feb;37(2):1052-1058.
REF 22 MiR-384 inhibits human colorectal cancer metastasis by targeting KRAS and CDC42. Oncotarget. 2016 Dec 20;7(51):84826-84838.
REF 23 Wnt/-catenin signaling inhibits FBXW7 expression by upregulation of microRNA-770 in hepatocellular carcinoma. Tumour Biol. 2016 May;37(5):6045-51.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.