Target Regulator(s) Information (MicroRNA)

Content Navigation (  All   None )                                      
Target General Information
The microRNAs (miRNAs) Regulating This Target
References
Target General Information  Top
Target ID T14731 Target Info
Target Name NAD-dependent deacetylase sirtuin-1 (SIRT1)
Synonyms hSIRT1; hSIR2; SIR2L1; SIR2-like protein 1; Regulatory protein SIR2 homolog 1; NAD-dependent protein deacetylase sirtuin-1
Target Type Clinical trial Target
Gene Name SIRT1
Biochemical Class Carbon-nitrogen hydrolase
UniProt ID
Q96EB6
The microRNAs (miRNAs) Regulating This Target  Top
miRNA Mature ID hsa-miR-34a-5p miRNA Info
miRNA Mature AC
MIMAT0000255
Sequence uggcagugucuuagcugguugu
miRNA Species Homo sapiens
Evidence Score (E-score) 18 +
1 Immunoblot; qRT-PCR [1]
2 Luciferase Reporter Assay [2]
3 Luciferase Reporter Assay [3]
4 Luciferase Reporter Assay; qRT-PCR; Western Blot [4]
5 Luciferase Reporter Assay; qRT-PCR; Western Blot [5]
6 Luciferase Reporter Assay; qRT-PCR; Western Blot [6]
7 Luciferase Reporter Assay; qRT-PCR; Western Blot [7]
8 Luciferase Reporter Assay; qRT-PCR; Western Blot [8]
9 Luciferase Reporter Assay; qRT-PCR; Western Blot [9]
10 Luciferase Reporter Assay; qRT-PCR; Western Blot [10]
11 Luciferase Reporter Assay; Western Blot [11]
12 Luciferase Reporter Assay; Western Blot [12]
13 Luciferase Reporter Assay; Western Blot; Northern Blot [13]
14 qRT-PCR; Western Blot [14]
15 Western Blot [15]
16 Western Blot [16]
17 Western Blot; Immunohistochemistry [17]
18 Western Blot; qRT-PCR; Luciferase Reporter Assay [18]
Representative Target(s) Regulated by This miRNA Amphiregulin (AREG) Target Info
AREG_HUMAN
Androgen receptor (AR) Target Info
ANDR_HUMAN
miRNA Mature ID hsa-miR-204-5p miRNA Info
miRNA Mature AC
MIMAT0000265
Sequence uucccuuugucauccuaugccu
miRNA Species Homo sapiens
Regulation Mechanism Luciferase reporter assay was carried to verify that miR-204 targeting SIRT1. [22]
Evidence Score (E-score) 4 +
1 Luciferase Reporter Assay [19]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [20]
3 Luciferase Reporter Assay; qRT-PCR; Western Blot [21]
4 Luciferase Reporter Assay; Western Blot [22]
Representative Target(s) Regulated by This miRNA Alkaline phosphatase tissue-nonspecific (ALPL) Target Info
PPBT_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-449a miRNA Info
miRNA Mature AC
MIMAT0001541
Sequence uggcaguguauuguuagcuggu
miRNA Species Homo sapiens
Regulation Mechanism Direct interaction of miR-449 with the target gene SIRT 3'UTR was confirmed. [25]
Evidence Score (E-score) 3 +
1 Immunoblot; Luciferase Reporter Assay; qRT-PCR [23]
2 Luciferase Reporter Assay; qRT-PCR; Western Blot [24]
3 Luciferase Reporter Assay; Western Blot [25]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
miRNA Mature ID hsa-miR-132-3p miRNA Info
miRNA Mature AC
MIMAT0000426
Sequence uaacagucuacagccauggucg
miRNA Species Homo sapiens
Regulation Mechanism An approximately 2-fold decrease in luciferase activity of the reporter construct in cells cotransfected with pre-miR-132 compared with the scrambled oligonucleotide contro suggesting miR-132 represses SirT1 translation through directly binding the response element in the SirT1 3'UTR. [27]
Evidence Score (E-score) 2 +
1 ChIP; Immunoprecipitation; Luciferase Reporter Assay; Microarray; qRT-PCR; Western Blot [26]
2 Luciferase Reporter Assay; Western Blot [27]
Representative Target(s) Regulated by This miRNA Brain-derived neurotrophic factor (BDNF) Target Info
BDNF_HUMAN
Cyclin A2 (CCNA2) Target Info
CCNA2_HUMAN
miRNA Mature ID hsa-miR-133b miRNA Info
miRNA Mature AC
MIMAT0000770
Sequence uuugguccccuucaaccagcua
miRNA Species Homo sapiens
Regulation Mechanism Expression level of miR-133b was decreased while Sirt1 mRNA expression levels were increased indicating SIRT1 as a direct target of miR-133b. [29]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [28]
2 Luciferase Reporter Assay [29]
Representative Target(s) Regulated by This miRNA Apoptosis mediating surface antigen FAS (FAS) Target Info
TNR6_HUMAN
Apoptosis regulator Bcl-W (BCL-W) Target Info
B2CL2_HUMAN
miRNA Mature ID hsa-miR-22-3p miRNA Info
miRNA Mature AC
MIMAT0000077
Sequence aagcugccaguugaagaacugu
miRNA Species Homo sapiens
Regulation Mechanism miR-22 inhibited cell proliferation, migration, and invasion via targeting the 3'UTR of SIRT1. [31]
Evidence Score (E-score) 2 +
1 Luciferase Reporter Assay [30]
2 Luciferase Reporter Assay; Western Blot [31]
Representative Target(s) Regulated by This miRNA 5-HT 2C receptor (HTR2C) Target Info
5HT2C_HUMAN
ATP-citrate synthase (ACLY) Target Info
ACLY_HUMAN
miRNA Mature ID hsa-miR-126-3p miRNA Info
miRNA Mature AC
MIMAT0000445
Sequence ucguaccgugaguaauaaugcg
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [32]
Representative Target(s) Regulated by This miRNA Adrenomedullin (ADM) Target Info
ADML_HUMAN
Angiopoietin 1 receptor (TEK) Target Info
TIE2_HUMAN
miRNA Mature ID hsa-miR-142-5p miRNA Info
miRNA Mature AC
MIMAT0000433
Sequence cauaaaguagaaagcacuacu
miRNA Species Homo sapiens
Regulation Mechanism SIRT1 was a potential miR-142 target. [33]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [33]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Hypoxia-inducible factor 1 alpha (HIF-1A) Target Info
HIF1A_HUMAN
miRNA Mature ID hsa-miR-155-3p miRNA Info
miRNA Mature AC
MIMAT0004658
Sequence cuccuacauauuagcauuaaca
miRNA Species Homo sapiens
Regulation Mechanism SIRT1 mRNA expression is directly regulated by miR-155. [34]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [34]
Representative Target(s) Regulated by This miRNA Cellular tumor antigen p53 (TP53) Target Info
P53_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-181c-5p miRNA Info
miRNA Mature AC
MIMAT0000258
Sequence aacauucaaccugucggugagu
miRNA Species Homo sapiens
Regulation Mechanism SIRT1 is targeted by miR-181c. [35]
Evidence Score (E-score) 1 +
1 In Situ Hybridization; Luciferase Reporter Assay [35]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Bone morphogenetic protein receptor (BMPR2) Target Info
BMPR2_HUMAN
miRNA Mature ID hsa-miR-199b-5p miRNA Info
miRNA Mature AC
MIMAT0000263
Sequence cccaguguuuagacuaucuguuc
miRNA Species Homo sapiens
Regulation Mechanism SIRT1 is a direct target of miR-199b. [36]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay [36]
Representative Target(s) Regulated by This miRNA Epithelial discoidin domain receptor 1 (DDR1) Target Info
DDR1_HUMAN
Erbb2 tyrosine kinase receptor (HER2) Target Info
ERBB2_HUMAN
miRNA Mature ID hsa-miR-200c-3p miRNA Info
miRNA Mature AC
MIMAT0000617
Sequence uaauacugccggguaaugaugga
miRNA Species Homo sapiens
Regulation Mechanism SIRT1 is a miR-200c target and luciferase activity for construct upon miR-200c overexpression is downmodulated. [37]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [37]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
miRNA Mature ID hsa-miR-216a-5p miRNA Info
miRNA Mature AC
MIMAT0000273
Sequence uaaucucagcuggcaacuguga
miRNA Species Homo sapiens
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [38]
Representative Target(s) Regulated by This miRNA Beclin-1 (BECN1) Target Info
BECN1_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
miRNA Mature ID hsa-miR-221-3p miRNA Info
miRNA Mature AC
MIMAT0000278
Sequence agcuacauugucugcuggguuuc
miRNA Species Homo sapiens
Regulation Mechanism SIRT1 protein levels of cells transfected with miR-221 inhibitor was increased. [39]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; qRT-PCR; Western Blot [39]
Representative Target(s) Regulated by This miRNA Bcl-2-binding component 3 (BBC3) Target Info
BBC3_HUMAN
Beclin-1 (BECN1) Target Info
BECN1_HUMAN
miRNA Mature ID hsa-miR-23b-3p miRNA Info
miRNA Mature AC
MIMAT0000418
Sequence aucacauugccagggauuaccac
miRNA Species Homo sapiens
Regulation Mechanism SIRT1 is a target mRNA of miR-23b-3p. [40]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [40]
Representative Target(s) Regulated by This miRNA Activin receptor type IIB (ACVR2B) Target Info
AVR2B_HUMAN
Carbonic anhydrase II (CA-II) Target Info
CAH2_HUMAN
miRNA Mature ID hsa-miR-29c-3p miRNA Info
miRNA Mature AC
MIMAT0000681
Sequence uagcaccauuugaaaucgguua
miRNA Species Homo sapiens
Regulation Mechanism miR-29c suppresses oncogenic SIRT1 by way of binding to 3'-untranslated region of SIRT1 mRNA causing translational inhibition in liver cancer cells. The loss or suppression of miR-29c may cause aberrant SIRT1 overexpression and promotes liver tumorigenesis. [41]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [41]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
B7 homolog 3 (CD276) Target Info
CD276_HUMAN
miRNA Mature ID hsa-miR-34a-3p miRNA Info
miRNA Mature AC
MIMAT0004557
Sequence caaucagcaaguauacugcccu
miRNA Species Homo sapiens
Regulation Mechanism Induction of SIRT1 is mediated by miR-34a. [42]
Evidence Score (E-score) 1 +
1 Western Blot [42]
Representative Target(s) Regulated by This miRNA Apoptosis regulator Bcl-2 (BCL-2) Target Info
BCL2_HUMAN
Beta-catenin (CTNNB1) Target Info
CTNB1_HUMAN
miRNA Mature ID hsa-miR-373-3p miRNA Info
miRNA Mature AC
MIMAT0000726
Sequence gaagugcuucgauuuuggggugu
miRNA Species Homo sapiens
Regulation Mechanism miR-373 increased the expression of MMP9 by directly targeting the 3'UTR of SIRT1 and suppressing their translation. [43]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [43]
Representative Target(s) Regulated by This miRNA B-cell translocation gene 1 protein (BTG1) Target Info
BTG1_HUMAN
Cell surface protein HB15 (CD83) Target Info
CD83_HUMAN
miRNA Mature ID hsa-miR-449b-5p miRNA Info
miRNA Mature AC
MIMAT0003327
Sequence aggcaguguauuguuagcuggc
miRNA Species Homo sapiens
Regulation Mechanism Direct interaction of miR-449 with the target gene SIRT 3'UTR was confirmed. [25]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [25]
Representative Target(s) Regulated by This miRNA Cyclin-dependent kinase 4 (CDK4) Target Info
CDK4_HUMAN
Cyclin-dependent kinase 6 (CDK6) Target Info
CDK6_HUMAN
miRNA Mature ID hsa-miR-520c-3p miRNA Info
miRNA Mature AC
MIMAT0002846
Sequence aaagugcuuccuuuuagagggu
miRNA Species Homo sapiens
Regulation Mechanism miR-520 increased the expression of MMP9 by directly targeting the 3'UTR of SIRT1 and suppressing their translation. [43]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [43]
Representative Target(s) Regulated by This miRNA Amyloid beta A4 protein (APP) Target Info
A4_HUMAN
Extracellular matrix receptor III (CD44) Target Info
CD44_HUMAN
miRNA Mature ID hsa-miR-543 miRNA Info
miRNA Mature AC
MIMAT0004954
Sequence aaacauucgcggugcacuucuu
miRNA Species Homo sapiens
Regulation Mechanism miR-543 directly targeted the 3'UTR of SIRT1. [44]
Evidence Score (E-score) 1 +
1 Luciferase Reporter Assay; Western Blot [44]
Representative Target(s) Regulated by This miRNA Focal adhesion kinase 1 (FAK) Target Info
FAK1_HUMAN
High mobility group protein HMGI-C (HMGA2) Target Info
HMGA2_HUMAN
References  Top
REF 1 FoxO3 increases miR-34a to cause palmitate-induced cholangiocyte lipoapoptosis. J Lipid Res. 2017 May;58(5):866-875.
REF 2 Upregulated sirtuin 1 by miRNA-34a is required for smooth muscle cell differentiation from pluripotent stem cells. Cell Death Differ. 2015 Jul;22(7):1170-80.
REF 3 The miR-34 family in cancer and apoptosis. Cell Death Differ. 2010 Feb;17(2):193-9.
REF 4 Oxidative stress dependent microRNA-34a activation via PI3K reduces the expression of sirtuin-1 and sirtuin-6 in epithelial cells. Sci Rep. 2016 Oct 21;6:35871.
REF 5 MicroRNA-34a affects chondrocyte apoptosis and proliferation by targeting the SIRT1/p53 signaling pathway during the pathogenesis of osteoarthritis. Int J Mol Med. 2016 Jul;38(1):201-9.
REF 6 Anti-cancer effects of naturally occurring compounds through modulation of signal transduction and miRNA expression in human colon cancer cells. J Nutr Biochem. 2013 Nov;24(11):1849-58.
REF 7 Targeting epigenetic regulation of miR-34a for treatment of pancreatic cancer by inhibition of pancreatic cancer stem cells. PLoS One. 2011;6(8):e24099.
REF 8 MicroRNA-34a regulation of endothelial senescence. Biochem Biophys Res Commun. 2010 Aug 6;398(4):735-40.
REF 9 MicroRNA-34a: a novel tumor suppressor in p53-mutant glioma cell line U251. Arch Med Res. 2010 Feb;41(2):67-74.
REF 10 A pathway involving farnesoid X receptor and small heterodimer partner positively regulates hepatic sirtuin 1 levels via microRNA-34a inhibition. J Biol Chem. 2010 Apr 23;285(17):12604-11.
REF 11 Tat-Mediated Induction of miRs-34a & -138 Promotes Astrocytic Activation via Downregulation of SIRT1: Implications for Aging in HAND. J Neuroimmune Pharmacol. 2017 Sep;12(3):420-432.
REF 12 MiR-34, SIRT1 and p53: the feedback loop. Cell Cycle. 2009 Mar 1;8(5):712-5.
REF 13 miR-34a repression of SIRT1 regulates apoptosis. Proc Natl Acad Sci U S A. 2008 Sep 9;105(36):13421-6.
REF 14 Myc overexpression brings out unexpected antiapoptotic effects of miR-34a. Oncogene. 2011 Jun 2;30(22):2587-94.
REF 15 MiR-34a inhibits migration and invasion by regulating the SIRT1/p53 pathway in human SW480 cells. Mol Med Rep. 2015 May;11(5):3301-7.
REF 16 MiR-34a deficiency accelerates medulloblastoma formation in vivo. Int J Cancer. 2015 May 15;136(10):2293-303.
REF 17 Dysregulation of the miR-34a-SIRT1 axis inhibits breast cancer stemness. Oncotarget. 2015 Apr 30;6(12):10432-44.
REF 18 Effects of miR-34a on cell growth and chemoresistance in prostate cancer PC3 cells. Biochem Biophys Res Commun. 2008 Dec 5;377(1):114-9.
REF 19 Long non-coding RNA ADNCR suppresses adipogenic differentiation by targeting miR-204. Biochim Biophys Acta. 2016 Jul;1859(7):871-82.
REF 20 miR-204-5p targeting SIRT1 regulates hepatocellular carcinoma progression. Cell Biochem Funct. 2016 Oct;34(7):505-510.
REF 21 MicroRNA-204 inhibits proliferation, migration, invasion and epithelial-mesenchymal transition in osteosarcoma cells via targeting Sirtuin 1. Oncol Rep. 2015 Jul;34(1):399-406.
REF 22 MiR-204 down regulates SIRT1 and reverts SIRT1-induced epithelial-mesenchymal transition, anoikis resistance and invasion in gastric cancer cells. BMC Cancer. 2013 Jun 14;13:290.
REF 23 Loss of miR-449a in ERG-associated prostate cancer promotes the invasive phenotype by inducing SIRT1. Oncotarget. 2016 Apr 19;7(16):22791-806.
REF 24 Inhibition of microRNA-449a prevents IL-1-induced cartilage destruction via SIRT1. Osteoarthritis Cartilage. 2016 Dec;24(12):2153-2161.
REF 25 miR-449 inhibits cell proliferation and is down-regulated in gastric cancer. Mol Cancer. 2011 Mar 18;10:29.
REF 26 Upregulated miR-132 in Lgr5+ gastric cancer stem cell-like cells contributes to cisplatin-resistance via SIRT1/CREB/ABCG2 signaling pathway. Mol Carcinog. 2017 Sep;56(9):2022-2034.
REF 27 MicroRNA 132 regulates nutritional stress-induced chemokine production through repression of SirT1. Mol Endocrinol. 2009 Nov;23(11):1876-84.
REF 28 miR-133b inhibits glioma cell proliferation and invasion by targeting Sirt1. Oncotarget. 2016 Jun 14;7(24):36247-36254.
REF 29 MicroRNA-133b inhibits hepatocellular carcinoma cell progression by targeting Sirt1. Exp Cell Res. 2016 May 1;343(2):135-147.
REF 30 miR-22 inhibits mouse ovarian granulosa cell apoptosis by targeting SIRT1. Biol Open. 2016 Feb 24;5(3):367-71.
REF 31 miR-22 inhibits the proliferation, motility, and invasion of human glioblastoma cells by directly targeting SIRT1. Tumour Biol. 2016 May;37(5):6761-8.
REF 32 MicroRNA-126 inhibits osteosarcoma cells proliferation by targeting Sirt1. Tumour Biol. 2013 Dec;34(6):3871-7.
REF 33 Up-regulation of microRNA-142 in simian immunodeficiency virus encephalitis leads to repression of sirtuin1. FASEB J. 2013 Sep;27(9):3720-9.
REF 34 miR-124a and miR-155 enhance differentiation of regulatory T cells in patients with neuropathic pain. J Neuroinflammation. 2016 Sep 20;13(1):248.
REF 35 Target gene repression mediated by miRNAs miR-181c and miR-9 both of which are down-regulated by amyloid-. J Mol Neurosci. 2012 Feb;46(2):324-35.
REF 36 Downregulation of miR-199b is associated with distant metastasis in colorectal cancer via activation of SIRT1 and inhibition of CREB/KISS1 signaling. Oncotarget. 2016 Jun 7;7(23):35092-105.
REF 37 Blood hsa-miR-122-5p and hsa-miR-885-5p levels associate with fatty liver and related lipoprotein metabolism-The Young Finns Study. Sci Rep. 2016 Dec 5;6:38262.
REF 38 MicroRNA 217 modulates endothelial cell senescence via silent information regulator 1. Circulation. 2009 Oct 13;120(15):1524-32.
REF 39 Down-regulation of mir-221 and mir-222 restrain prostate cancer cell proliferation and migration that is partly mediated by activation of SIRT1. PLoS One. 2014 Jun 3;9(6):e98833.
REF 40 miR-23b-3p induces the cellular metabolic memory of high glucose in diabetic retinopathy through a SIRT1-dependent signalling pathway. Diabetologia. 2016 Mar;59(3):644-54.
REF 41 MicroRNA-29c functions as a tumor suppressor by direct targeting oncogenic SIRT1 in hepatocellular carcinoma. Oncogene. 2014 May 15;33(20):2557-67.
REF 42 Shear-sensitive microRNA-34a modulates flow-dependent regulation of endothelial inflammation. J Cell Sci. 2015 Jan 1;128(1):70-80.
REF 43 miR-520c and miR-373 upregulate MMP9 expression by targeting mTOR and SIRT1, and activate the Ras/Raf/MEK/Erk signaling pathway and NF-B factor in human fibrosarcoma cells. J Cell Physiol. 2012 Feb;227(2):867-76.
REF 44 miR-543 promotes gastric cancer cell proliferation by targeting SIRT1. Biochem Biophys Res Commun. 2016 Jan 1;469(1):15-21.

If You Find Any Error in Data or Bug in Web Service, Please Kindly Report It to Dr. Zhou and Dr. Zhang.